Detailed information of regulator


Regulator ID REG0166 experimental
Regulator type protein
Regulatory pathway (from literatures) QS regulatory pathway
KEGG pathway (determined by BlastKOALA) Quorum sensing (map02024); Biofilm formation - Pseudomonas aeruginosa (map02025)
Related T6SS T6SS00152 experimental (Type i1); T6SS00151 experimental (Type i4a); T6SS00150 experimental (Type i3)
Strain Pseudomonas aeruginosa UCBPP-PA14
Replicon chromosome
Sequence Protein sequence (240 a.a.); Nucleotide sequence (720 bp)
Description Transcription of hcp2 and hcp3 was affected in the QS mutants, demonstrating that LasR control hcp2 and hcp3 expression. In contrast, hcp1 transcript levels were maintained at low levels of expression, which increased in ΔlasR mutant, suggesting that LasR repress the HSI-I effector hcp1.; No LasR binding sites in either HSI-I or HSI-III were found, suggesting that LasR does not directly bind to these loci.Transcription of hcp2 and hcp3 was affected in the QS mutants ΔlasR, demonstrating that LasR control hcp2 and hcp3 expression. In contrast, hcp1 transcript levels were maintained at low levels of expression, which increased in ΔlasR mutant, suggesting that LasR repress the HSI-I effector hcp1.

External database links

Locus tag (Gene) PA14_45960 (lasR)
Coordinates (Strand) 4085339..4086058 (-)
NCBI ID 489173455
RefSeq NC_008463
KEGG ID pau:PA14_45960, pae:PA1430
KEGG pathway (determined by BlastKOALA) map02024; map02025
PDB ID 3IX4, 6D6A, 6V7W, 6D6O, 6MWL, 6MVM, 2UV0, 3JPU, 6D6D, 6D6L, 6D6M, 6MWW, 4NG2, 6MWH, 6D6C, 6V7X, 6MVN, 6D6P, 3IX8, 3IX3, 6D6N, 6MWZ, 6D6B

Target Regulation (↓/↑) Target sequence
TssA2 (PA14_43050) promotor A LasR box (AACTACCTGTTTTGGTAGGG)
HSI-III transcripts -
HSI-I transcripts -

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
Autoind_bind PF03472.17 1.3e-37 18..160
GerE PF00196.21 3.1e-22 176..231

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9926 - -

  Protein sequence of regulator: 240 a.a.    .

>REG0166 NC_008463:c4086058-4085339 [Pseudomonas aeruginosa UCBPP-PA14]

  Nucleotide sequence of regulator: 720 bp    .

>REG0166 NC_008463:c4086058-4085339 [Pseudomonas aeruginosa UCBPP-PA14]