Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QUE82_RS02190 Genome accession   NZ_AP028059
Coordinates   435659..435781 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. natto strain NARUSE     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 430659..440781
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QUE82_RS02175 (BSNN_03970) yclJ 432273..432956 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QUE82_RS02180 (BSNN_03980) yclK 432943..434364 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QUE82_RS02185 (BSNN_03990) rapC 434527..435675 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QUE82_RS02190 (BSNN_04000) phrC 435659..435781 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QUE82_RS02195 yczM 435880..435969 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QUE82_RS02200 yczN 436051..436164 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  QUE82_RS02205 (BSNN_04010) thrD 436317..437681 (-) 1365 WP_014478832.1 aspartate kinase -
  QUE82_RS02210 (BSNN_04020) ceuB 438072..439022 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QUE82_RS02215 (BSNN_04030) yclO 439015..439962 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  QUE82_RS02220 (BSNN_04040) yclP 439956..440714 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=92303 QUE82_RS02190 WP_003224994.1 435659..435781(+) (phrC) [Bacillus subtilis subsp. natto strain NARUSE]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=92303 QUE82_RS02190 WP_003224994.1 435659..435781(+) (phrC) [Bacillus subtilis subsp. natto strain NARUSE]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment