Detailed information of regulator

Summary

Regulator ID	REG0059
Regulator type	ncRNA
Regulatory pathway (from literatures)	QS regulatory pathway
KEGG pathway (determined by BlastKOALA)	-
Related T6SS	T6SS00003 (Type i3); T6SS00004 (Type i1)
Strain	Pseudomonas aeruginosa PAO1
Replicon	chromosome
Sequence	Nucleotide sequence (151 bp)
Description	PrrF positively affects the expression ofthe Hcp1 secretion island II type VIsecretion system(HSI-II T6SS).
Reference	[1] Brewer LK, Huang W, Hackert BJ, et al. Static Growth Promotes PrrF and 2-Alkyl-4(1H)-Quinolone Regulation of Type VI Secretion Protein Expression in Pseudomonas aeruginosa. J Bacteriol. 2020 Nov 19;202(24). pii: e00416-20. doi: 10.1128/JB.00416-20. Print 2020 Nov 19. PMID: 33020221

---

External database links

Locus tag (Gene)	PA4704.1 (prrF1)
Coordinates (Strand)	5283960..5284110 (+)
NCBI ID	4179187
RefSeq	NC_002516

---

  Target

Target	Regulation (↓/↑)	Target sequence
T6SS transcripts	↓	ttgacatggaaatgagaatcattattatgtcactcaactggtcgcgagatcagccggtaagctgagagacccacgcagtcggactcttcagattatctcctcatcaggctaatcacggtttttgacccggcactttgccgggtcttttttt

---

  Nucleotide sequence of regulator: 151 bp    .Download