Detailed information of regulator
Summary
| Regulator ID | REG0009  |
| Regulator type | ncRNA |
| Regulatory pathway (from literatures) | RsmA regulatory pathway |
| KEGG pathway (determined by BlastKOALA) | - |
| Related T6SS | T6SS01211 (Type i1); T6SS01212 (Type i4a); T6SS01213 (Type i3) |
| Strain | Pseudomonas aeruginosa PAO1 |
| Replicon | chromosome |
| Sequence | Nucleotide sequence (116 bp) |
| Description | Deletion of gacA or rsmY/rsmZ reduced the level of Hcp1 in the suhB mutant background. In addition, overexpression of rsmA suppressed the expression of Hcp1 in the suhB mutant. |
| Reference | [1] Chen R, Weng Y, Zhu F, et al. Polynucleotide Phosphorylase Regulates Multiple Virulence Factors and the Stabilities of Small RNAs RsmY/Z in Pseudomonas aeruginosa. Front Microbiol. 2016 Mar 2;7:247. doi: 10.3389/fmicb.2016.00247. eCollection 2016. PMID: 26973625 [2] Li K, Xu C, Jin Y, et al. SuhB is a regulator of multiple virulence genes and essential for pathogenesis of Pseudomonas aeruginosa. mBio. 2013 Oct 29;4(6):e00419-13. doi: 10.1128/mBio.00419-13. PMID: 24169572 |
External database links
| Locus tag (Gene) | PA3621.1 (RsmZ) |
| Coordinates (Strand) | 4057543..4057658 (-) |
| NCBI ID | - |
| RefSeq | NZ_CP020659 |
Target
| Target | Regulation (↓/↑) | Target sequence |
|---|---|---|
| RsmA (Y880_06257) | ↓ | cgtacagggaacacgcaaccccgaaggatcggggaagggacgtcgccagggaggcgattcatcaggatgatgacgagggactgaagagtgggcggggtaataccccgccccttttt |
Nucleotide sequence of regulator: 116 bp .
>REG0009 NZ_CP020659:c4057658-4057543 [Pseudomonas aeruginosa PAK]
CGGCGATCGCGGTCGCTACTGGGGCGACGGTACCCTGGAATTCCTCGGTCGGGTCGACCAGCAGGTGAAAGTGCGCGGCC
AGCGCATCGAGTTGGGCGAGGTGGAGGCCGCGCTGT
CGGCGATCGCGGTCGCTACTGGGGCGACGGTACCCTGGAATTCCTCGGTCGGGTCGACCAGCAGGTGAAAGTGCGCGGCC
AGCGCATCGAGTTGGGCGAGGTGGAGGCCGCGCTGT