Detailed information NTG0529170

Bioinformatically predicted

Overview

• Name: ssbB
• Type: Machinery gene
• Locus tag: LLF72_RS02090
• Genome accession: NZ_CP068511
• Coordinates: 413249..413638 (+)
• Length: 129 a.a.
• NCBI ID: WP_015082043.1
• Uniprot ID: -
• Organism: Lactococcus cremoris strain F.2.7
• Function: ssDNA binding (predicted from homology) DNA processing

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
Prophage	413220..424828	413249..413638	within	0

Gene organization within MGE regions

Location: 413220..424828

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
LLF72_RS02090 (LLF72_02045)	ssbB	413249..413638 (+)	390	WP_015082043.1	single-stranded DNA-binding protein	Machinery gene
LLF72_RS02095 (LLF72_02050)	groES	413757..414041 (+)	285	WP_011675464.1	co-chaperone GroES	-
LLF72_RS02100 (LLF72_02055)	groL	414128..415756 (+)	1629	WP_011675465.1	chaperonin GroEL	-
LLF72_RS02105 (LLF72_02060)	-	415808..416620 (-)	813	WP_011675466.1	MBL fold metallo-hydrolase	-
LLF72_RS02110 (LLF72_02065)	-	416810..418237 (-)	1428	WP_011675468.1	cell wall metabolism sensor histidine kinase WalK	-
LLF72_RS02115 (LLF72_02070)	yycF	418230..418931 (-)	702	WP_003131580.1	response regulator YycF	-
LLF72_RS02120 (LLF72_02075)	tmk	419109..419744 (+)	636	WP_015082045.1	dTMP kinase	-
LLF72_RS02125 (LLF72_02080)	-	419877..420737 (+)	861	WP_011675470.1	DNA polymerase III subunit delta'	-
LLF72_RS02130 (LLF72_02085)	ricT	420787..421569 (+)	783	WP_015082046.1	stage 0 sporulation family protein	-
LLF72_RS02135 (LLF72_02090)	yabA	421562..421888 (+)	327	WP_011675472.1	DNA replication initiation control protein YabA	-
LLF72_RS02140 (LLF72_02095)	rsmI	421888..422763 (+)	876	WP_041931741.1	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	-
LLF72_RS02145 (LLF72_02100)	-	422841..423032 (-)	192	WP_011675474.1	hypothetical protein	-
LLF72_RS13050	-	423107..423915 (-)	809	Protein_415	ABC transporter permease	-

Sequence

Protein

• Length: 129 a.a.
• Molecular weight: 14683.78 Da
• Isoelectric Point: 6.9865

>NTDB_id=529170 LLF72_RS02090 WP_015082043.1 413249..413638(+) (ssbB) [Lactococcus cremoris strain F.2.7]
MNKTMLIGRLTNAPEISKTTNNKSYVRVTLAINRRFKNEKGEREADFISIILWGKSAETLVSYAKKGSLISVEGEIRTRN
YSDKNEQKHCITEILGLSYDLLESRATLALRESAINFEELLLEADELPF

Nucleotide

• Length: 390 bp

>NTDB_id=529170 LLF72_RS02090 WP_015082043.1 413249..413638(+) (ssbB) [Lactococcus cremoris strain F.2.7]
ATGAATAAAACCATGTTGATTGGTCGTTTAACAAACGCACCTGAAATTTCGAAAACAACGAACAATAAATCTTATGTCCG
TGTGACTCTGGCAATCAATCGCCGCTTCAAAAATGAAAAAGGAGAGCGAGAAGCAGACTTTATCTCGATAATTTTATGGG
GAAAATCAGCAGAAACATTGGTTTCCTATGCTAAAAAAGGAAGTCTTATTTCTGTAGAGGGAGAGATTAGAACTAGAAAT
TATTCTGATAAAAATGAACAGAAACACTGTATTACAGAAATCTTAGGTTTGAGCTATGATTTATTGGAAAGTCGTGCGAC
TCTTGCCTTGAGAGAAAGCGCTATAAATTTTGAGGAACTCTTACTTGAAGCTGATGAGCTCCCTTTCTAA

Domains

Predicted by InterproScan.

• Single-strand binding protein family (SSB) (1-95)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
ssbB	Lactococcus lactis subsp. cremoris KW2	95.349	100	0.953
ssbB	Streptococcus sobrinus strain NIDR 6715-7	60	100	0.605
ssbB/cilA	Streptococcus pneumoniae TIGR4	56.154	100	0.566
ssbB/cilA	Streptococcus pneumoniae Rx1	55.385	100	0.558
ssbB/cilA	Streptococcus pneumoniae D39	55.385	100	0.558
ssbB/cilA	Streptococcus pneumoniae R6	55.385	100	0.558
ssbB/cilA	Streptococcus mitis NCTC 12261	55.385	100	0.558
ssbB/cilA	Streptococcus mitis SK321	55.385	100	0.558
ssbA	Streptococcus mutans UA159	55.385	100	0.558