NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	ES276_RS09730	Genome accession	NZ_CP038252
Coordinates	1928944..1929246 (-)	Length	100 a.a.
NCBI ID	WP_000413382.1	Uniprot ID	C0HMA8
Organism	Streptococcus pneumoniae strain TVO_1901936
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1923944..1934246

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
ES276_RS09700 (ES276_10315)	rnpA	1924623..1924994 (-)	372	WP_000739253.1	ribonuclease P protein component	-
ES276_RS10870	-	1925011..1925142 (-)	132	WP_000768904.1	hypothetical protein	-
ES276_RS09705 (ES276_10320)	-	1925143..1926333 (-)	1191	WP_000167757.1	acetate kinase	-
ES276_RS09710 (ES276_10325)	comGH	1926384..1927337 (-)	954	WP_000345135.1	class I SAM-dependent methyltransferase	Machinery gene
ES276_RS09715 (ES276_10330)	-	1927398..1927992 (-)	595	Protein_1916	class I SAM-dependent methyltransferase	-
ES276_RS09720 (ES276_10335)	comGG/cglG	1928129..1928542 (-)	414	WP_000265622.1	competence type IV pilus minor pilin ComGG	Machinery gene
ES276_RS09725 (ES276_10340)	comGF/cglF	1928520..1928981 (-)	462	WP_000250534.1	competence type IV pilus minor pilin ComGF	Machinery gene
ES276_RS09730 (ES276_10345)	comGE/cglE	1928944..1929246 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
ES276_RS09735 (ES276_10350)	comGD/cglD	1929209..1929613 (-)	405	WP_000588028.1	competence type IV pilus minor pilin ComGD	Machinery gene
ES276_RS09740 (ES276_10355)	comGC/cglC	1929606..1929932 (-)	327	WP_000738627.1	comG operon protein ComGC	Machinery gene
ES276_RS09745 (ES276_10360)	comGB/cglB	1929934..1930950 (-)	1017	WP_074196785.1	competence type IV pilus assembly protein ComGB	Machinery gene
ES276_RS09750 (ES276_10365)	comGA/cglA/cilD	1930898..1931839 (-)	942	WP_000249564.1	competence type IV pilus ATPase ComGA	Machinery gene
ES276_RS09755 (ES276_10370)	-	1931915..1932280 (-)	366	WP_000286415.1	DUF1033 family protein	-
ES276_RS09760 (ES276_10375)	-	1932431..1933489 (-)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11108.08 Da Isoelectric Point: 9.7273

                                >NTDB_id=310272 ES276_RS09730 WP_000413382.1 1928944..1929246(-) (comGE/cglE) [Streptococcus pneumoniae strain TVO_1901936]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=310272 ES276_RS09730 WP_000413382.1 1928944..1929246(-) (comGE/cglE) [Streptococcus pneumoniae strain TVO_1901936]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure
AlphaFold DB	C0HMA8

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comGE	Streptococcus mutans UA140	44.444	90	0.4
comGE	Streptococcus mutans UA159	44.444	90	0.4

Detailed information NTG0310272