Detailed information NTG0183306

Bioinformatically predicted

Overview

• Name: ssbB
• Type: Machinery gene
• Locus tag: LLUC109_RS02135
• Genome accession: NZ_CP015907
• Coordinates: 417176..417565 (+)
• Length: 129 a.a.
• NCBI ID: WP_015082043.1
• Uniprot ID: -
• Organism: Lactococcus cremoris strain UC109
• Function: ssDNA binding (predicted from homology) DNA processing

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
Prophage	417180..428788	417176..417565	flank	-385

Gene organization within MGE regions

Location: 417176..428788

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
LLUC109_RS02135 (LLUC109_0404)	ssbB	417176..417565 (+)	390	WP_015082043.1	single-stranded DNA-binding protein	Machinery gene
LLUC109_RS02140 (LLUC109_0405)	groES	417684..417968 (+)	285	WP_011675464.1	co-chaperone GroES	-
LLUC109_RS02145 (LLUC109_0406)	groL	418055..419683 (+)	1629	WP_011675465.1	chaperonin GroEL	-
LLUC109_RS02150 (LLUC109_0407)	-	419735..420547 (-)	813	WP_011675466.1	MBL fold metallo-hydrolase	-
LLUC109_RS02155 (LLUC109_0408)	-	420737..422164 (-)	1428	WP_011675468.1	cell wall metabolism sensor histidine kinase WalK	-
LLUC109_RS02160 (LLUC109_0409)	yycF	422157..422858 (-)	702	WP_003131580.1	response regulator YycF	-
LLUC109_RS02165 (LLUC109_0410)	tmk	423036..423671 (+)	636	WP_015082045.1	dTMP kinase	-
LLUC109_RS02170 (LLUC109_0411)	-	423804..424664 (+)	861	WP_011675470.1	DNA polymerase III subunit delta'	-
LLUC109_RS02175 (LLUC109_0412)	ricT	424714..425496 (+)	783	WP_015082046.1	stage 0 sporulation family protein	-
LLUC109_RS02180 (LLUC109_0413)	yabA	425489..425815 (+)	327	WP_011675472.1	DNA replication initiation control protein YabA	-
LLUC109_RS02185 (LLUC109_0414)	rsmI	425815..426690 (+)	876	WP_041931741.1	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	-
LLUC109_RS02190 (LLUC109_0415)	-	426768..426959 (-)	192	WP_011675474.1	hypothetical protein	-
LLUC109_RS12430	-	427034..427842 (-)	809	Protein_424	ABC transporter permease	-
LLUC109_RS02205 (LLUC109_0417)	-	427855..428784 (-)	930	WP_011675476.1	daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein	-

Sequence

Protein

• Length: 129 a.a.
• Molecular weight: 14683.78 Da
• Isoelectric Point: 6.9865

>NTDB_id=183306 LLUC109_RS02135 WP_015082043.1 417176..417565(+) (ssbB) [Lactococcus cremoris strain UC109]
MNKTMLIGRLTNAPEISKTTNNKSYVRVTLAINRRFKNEKGEREADFISIILWGKSAETLVSYAKKGSLISVEGEIRTRN
YSDKNEQKHCITEILGLSYDLLESRATLALRESAINFEELLLEADELPF

Nucleotide

• Length: 390 bp

>NTDB_id=183306 LLUC109_RS02135 WP_015082043.1 417176..417565(+) (ssbB) [Lactococcus cremoris strain UC109]
ATGAATAAAACCATGTTGATTGGTCGTTTAACAAACGCACCTGAAATTTCGAAAACAACGAACAATAAATCTTATGTCCG
TGTGACTCTGGCAATCAATCGCCGCTTCAAAAATGAAAAAGGAGAGCGAGAAGCAGACTTTATCTCGATAATTTTATGGG
GAAAATCAGCAGAAACATTGGTTTCCTATGCTAAAAAAGGAAGTCTTATTTCTGTAGAGGGAGAGATTAGAACTAGAAAT
TATTCTGATAAAAATGAACAGAAACACTGTATTACAGAAATCTTAGGTTTGAGCTATGATTTATTGGAAAGTCGTGCGAC
TCTTGCCTTGAGAGAAAGCGCTATAAATTTTGAGGAACTCTTACTTGAAGCTGATGAGCTCCCTTTCTAA

Domains

Predicted by InterproScan.

• Single-strand binding protein family (SSB) (1-95)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
ssbB	Lactococcus lactis subsp. cremoris KW2	95.349	100	0.953
ssbB	Streptococcus sobrinus strain NIDR 6715-7	60	100	0.605
ssbB/cilA	Streptococcus pneumoniae TIGR4	56.154	100	0.566
ssbB/cilA	Streptococcus pneumoniae Rx1	55.385	100	0.558
ssbB/cilA	Streptococcus pneumoniae D39	55.385	100	0.558
ssbB/cilA	Streptococcus pneumoniae R6	55.385	100	0.558
ssbB/cilA	Streptococcus mitis NCTC 12261	55.385	100	0.558
ssbB/cilA	Streptococcus mitis SK321	55.385	100	0.558
ssbA	Streptococcus mutans UA159	55.385	100	0.558