Detailed information of regulator


Summary

Regulator ID REG0344 experimental
Regulator type protein
Regulatory pathway (from literatures) QS regulatory pathway
KEGG pathway (determined by BlastKOALA) RNA degradation (map03018); Quorum sensing (map02024); Biofilm formation - Vibrio cholerae (map05111)
Related T6SS T6SS01214 experimental (Type Unknown)
Strain Klebsiella pneumoniae strain Kp52.145
Replicon chromosome
Sequence Protein sequence (103 a.a.); Nucleotide sequence (309 bp)
Description The expression of tssB::lucFF was significantly higher in the h-ns, mgrB and rcsB mutant backgrounds than in the wild-type one and E. coli was not killed when co-incubated with rpoN, rpoS, hfq, fur and pmrAB mutants.
Reference

External database links

Locus tag (Gene) BN49_RS26620 (hfq)
Coordinates (Strand) 5173711..5174019 (-)
NCBI ID 488974767
RefSeq NZ_FO834906
Uniprot ID A0A0H3GQJ6_KLEPH, V0AUS1_KLEPN, A0A0E1CL72_KLEPN, W8UPJ3_KLEPN, A0A1C1EWG5_9ENTR, A0A1F2M460_9ENTR, A0A223UI03_9ENTR, A0A087FTJ6_KLEVA, HFQ_KLEP7, HFQ_KLEP3, A0A2W0X2F6_KLEPN, R4Y4W4_KLEPR
KEGG ID kpn:KPN_04570, kqu:AVR78_06760, kpe:KPK_5098, kps:KPNJ2_05007, kpw:KPNIH30_02275, kpm:KPHS_04160, kpv:KPNIH29_02240, kpa:KPNJ1_05061, kpt:VK055_2894, kpk:A593_12920, kvd:KR75_10365, kvq:SP68_16955, kpg:KPNIH32_02285, kpr:KPR_0546, kpy:KPNIH31_02300
KEGG pathway (determined by BlastKOALA) map03018; map02024; map05111
PDB ID -

  Target
Target Regulation (↓/↑) Target sequence
TssB transcription -

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
Hfq PF17209.5 6.3e-31 7..69

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence
Outside 1-102 MAKGQSLQDPFLNALRRERVPVSIYLVNGIKLQGQIESFDQFVILLKNTVSQMVYKHAISTVVPSRPVSHHSNNAGGGSSNYHHGGSAQGSSAPQQDSDDAE



Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9910 - -



  Protein sequence of regulator: 103 a.a.    .

>REG0344 NZ_FO834906:c5174019-5173711 [Klebsiella pneumoniae]
MAKGQSLQDPFLNALRRERVPVSIYLVNGIKLQGQIESFDQFVILLKNTVSQMVYKHAISTVVPSRPVSHHSNNAGGGSS
NYHHGGSAQGSSAPQQDSDDAE*

  Nucleotide sequence of regulator: 309 bp    .

>REG0344 NZ_FO834906:c5174019-5173711 [Klebsiella pneumoniae]
ATGGCTAAGGGGCAATCTTTACAAGATCCGTTCCTGAACGCTTTGCGTCGGGAACGCGTTCCGGTTTCTATTTATTTGGT
GAATGGTATCAAGCTGCAAGGGCAAATTGAGTCTTTCGATCAGTTCGTGATCCTGTTGAAGAACACGGTCAGCCAGATGG
TCTATAAGCACGCAATTTCTACTGTTGTCCCGTCTCGCCCGGTGTCTCACCACAGCAACAATGCTGGCGGCGGTTCCAGT
AACTATCACCACGGTGGTAGCGCGCAGGGTTCTTCTGCGCCGCAACAAGACAGCGACGACGCCGAATAA