Detailed information of regulator


Summary

Regulator ID REG0299 experimental
Regulator type protein
Regulatory pathway (from literatures) QS regulatory pathway
KEGG pathway (determined by BlastKOALA) RNA degradation (map03018); Quorum sensing (map02024); Biofilm formation - Vibrio cholerae (map05111)
Related T6SS T6SS01112 experimental (Type i1)
Strain Vibrio cholerae strain A1552
Replicon chromosome
Sequence Protein sequence (88 a.a.); Nucleotide sequence (264 bp)
Description In the Δhfq mutant the expression of Hcp was increased at the earlier growth phase to the same extent as in the case of the ΔluxO mutant
Reference

External database links

Locus tag (Gene) VCA1552_RS00505 (hfq)
Coordinates (Strand) 92673..92936 (+)
NCBI ID 446974616
RefSeq NZ_CP024867
Uniprot ID A0A067BLS3_VIBMT, HFQ_VIBCH, A0A0X1L5K7_VIBCO, HFQ_VIBC3, D7HI07_VIBCL, A0A0K9UGM0_VIBCL, A0A0H3QAM2_VIBCL, HFQ_VIBCM, A0A085SA74_VIBCL, D0ID29_9VIBR
KEGG ID vcr:VC395_0390, vco:VC0395_A2758, vcq:EN18_18670, vcm:VCM66_0331, vcz:VAB027_3485, vch:VC_0347
KEGG pathway (determined by BlastKOALA) map03018; map02024; map05111
PDB ID -

  Target
Target Regulation (↓/↑) Target sequence
VCA1552_00351 (HapR) -

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
Hfq PF17209.5 2.4e-31 7..69

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence
Outside 1-87 MAKGQSLQDPFLNALRRERIPVSIYLVNGIKLQGQIESFDQFVILLKNTVNQMVYKHAISTVVPARPVSHHSGDRPASDRPAEKSEE



Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9902 - -



  Protein sequence of regulator: 88 a.a.    .

>REG0299 NZ_CP024867:92673-92936 [Vibrio cholerae]
MAKGQSLQDPFLNALRRERIPVSIYLVNGIKLQGQIESFDQFVILLKNTVNQMVYKHAISTVVPARPVSHHSGDRPASDR
PAEKSEE*

  Nucleotide sequence of regulator: 264 bp    .

>REG0299 NZ_CP024867:92673-92936 [Vibrio cholerae]
ATGGCTAAGGGGCAATCTCTACAAGACCCATTTCTGAATGCACTACGTCGTGAACGTATCCCTGTTTCTATCTACCTTGT
GAACGGCATTAAACTGCAAGGTCAGATCGAATCATTTGATCAATTTGTGATCTTGCTGAAGAACACAGTAAACCAAATGG
TTTACAAGCATGCGATTTCTACTGTGGTTCCTGCTCGTCCAGTTAGCCACCACAGCGGCGACCGCCCAGCATCGGATCGT
CCAGCAGAGAAGTCTGAAGAGTAA