Detailed information of regulator


Regulator ID REG0252 experimental
Regulator type protein
Regulatory pathway (from literatures) Global regulator
KEGG pathway (determined by BlastKOALA) Mismatch repair (map03430)
Related T6SS T6SS00464 experimental (Type i4b)
Strain Escherichia coli 042
Replicon chromosome
Sequence Protein sequence (279 a.a.); Nucleotide sequence (837 bp)
Description Methylation of GATC-32 caused a significant decrease of 267 affinity of Fur for the P4532 promoter and A Dam-methylated P4532 fragment was subjected to EMSA with the reconstituted σ70-RNAP complex shows σ70-RNAP binding was diminished on the methylated P4532 fragment.By contrast, the activity of the promoter fusion in the fur-dam strain increased ~ 16-fold compared to the wild-type strain,and ~1.4-fold compared to the fur mutant.

External database links

Locus tag (Gene) EC042_RS19435 (Dam)
Coordinates (Strand) 3861171..3862007 (-)
NCBI ID 446664793
RefSeq NC_017626
KEGG ID elo:EC042_3648
KEGG pathway (determined by BlastKOALA) map03430

Target Regulation (↓/↑) Target sequence
EC042_4532 promoter gcgaatatcccatggagcagcaggcacaaattattgctgatcattttactttgcaggctgaaggatacgggacatggtgtgatatgagaagggacggtgatatcacactggacggaaatatgtctgagtatgttattcgcagcctgtataccagcacgttgcgggggttcccatg The red sequences indicate Fur binding boxes and GATC Dam methylation sites are indicated in bold blue letters

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
MethyltransfD12 PF02086.17 3.9e-75 10..251

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9945 - -

  Protein sequence of regulator: 279 a.a.    .

>REG0252 NC_017626:c3862007-3861171 [Escherichia coli 042]

  Nucleotide sequence of regulator: 837 bp    .

>REG0252 NC_017626:c3862007-3861171 [Escherichia coli 042]