Detailed information of regulator


Regulator ID REG0251 experimental
Regulator type protein
Regulatory pathway (from literatures) Global regulator
KEGG pathway (determined by BlastKOALA) -
Related T6SS T6SS00464 experimental (Type i4b)
Strain Escherichia coli 042
Replicon chromosome
Sequence Protein sequence (149 a.a.); Nucleotide sequence (447 bp)
Description The P4532-lacZ translational fusion is responsive to iron limitation and Fur and the P4532 promoter is repressed by the 194 Fur transcriptional regulator in an iron-dependent manner and EMSA shows Fur binds to the P4532 promoter and limits access to the RNA polymerase; EMSA shows Fur bound to the sci1 promoter,yielding two bands due to the presence of two Fur boxes

External database links

Locus tag (Gene) EC042_RS03685 (Fur)
Coordinates (Strand) 786918..787364 (-)
NCBI ID 446053847
RefSeq NC_017626
KEGG ID ecz:ECS88_0719, esl:O3K_18225, eci:UTI89_C0687, eco:b0683, ecq:ECED1_0664, elh:ETEC_0700, ecm:EcSMS35_0705, ebd:ECBD_2978, ecc:c0770, sdy:SDY_0623, eln:NRG857_03085, ect:ECIAI39_0640, elw:ECW_m0735, ecv:APECO1_1381, ecw:EcE24377A_0711, ece:Z0831, eum:ECUMN_0768, ecj:JW0669, elo:EC042_0711, eck:EC55989_0669, ecg:E2348C_0574, ecs:ECs0714, efe:EFER_2426
KEGG pathway (determined by BlastKOALA) -

Target Regulation (↓/↑) Target sequence
EC042_4532 promoter gcgaatatcccatggagcagcaggcacaaattattgctgatcattttactttgcaggctgaaggatacgggacatggtgtgatatgagaagggacggtgatatcacactggacggaaatatgtctgagtatgttattcgcagcctgtataccagcacgttgcgggggttcccatg The red sequences indicate Fur binding boxes and GATC Dam methylation sites are indicated in bold blue letters
EC042_4524 (TssB) promotor cctgattatttgcattatatcgatcgatgtatctgttatattgagatttttcagatcttcgtcctataatgatcaaaattaaatcagtgcacaaggggaggcatctgcggtgatggaacccctgagatgcaggtttcacaggagagagccatg The red sequences indicate Fur binding boxes and GATC Dam methylation sites are indicated in bold blue letters

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
FUR PF01475.21 1.4e-49 10..130

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9976 - -

  Protein sequence of regulator: 149 a.a.    .

>REG0251 NC_017626:c787364-786918 [Escherichia coli 042]

  Nucleotide sequence of regulator: 447 bp    .

>REG0251 NC_017626:c787364-786918 [Escherichia coli 042]