Detailed information of regulator


Regulator ID REG0206 experimental
Regulator type protein
Regulatory pathway (from literatures) TCS regulatory pathway
KEGG pathway (determined by BlastKOALA) Biofilm formation - Vibrio cholerae (map05111); Biofilm formation - Escherichia coli (map02026)
Related T6SS T6SS00372 experimental (Type i4b)
Strain Edwardsiella tarda EIB202
Replicon chromosome
Sequence Protein sequence (329 a.a.); Nucleotide sequence (987 bp)
Description RpoS negatively regulates secretion of T6SS products by inhibiting expression of EsrB through repressing the activity of the esrB promoter.

External database links

Locus tag (Gene) ETAE_2873 (RpoS)
Coordinates (Strand) 3025094..3026080 (-)
NCBI ID 502612732
RefSeq NC_013508
KEGG ID etr:ETAE_2873, etd:ETAF_2609
KEGG pathway (determined by BlastKOALA) map05111; map02026

Target Regulation (↓/↑) Target sequence
ETAE_0886 (esrB) promoter aaaaaaaggcgttcagcgaaggtctggttattcaaatgccccgagcgagctatatgaagttttcagtgtgccactgattcggagtaccctttaaatatg

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
Sigma70_r3 PF04539.18 1.3e-20 173..247
Sigma70_r2 PF04542.16 8.9e-20 93..162
Sigma70_r4 PF04545.18 2.6e-15 261..314
Sigma70_r1_2 PF00140.22 1.1e-11 55..88

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9948 - -

  Protein sequence of regulator: 329 a.a.    .

>REG0206 NC_013508:c3026080-3025094 [Edwardsiella tarda EIB202]

  Nucleotide sequence of regulator: 987 bp    .

>REG0206 NC_013508:c3026080-3025094 [Edwardsiella tarda EIB202]