Detailed information of regulator


Regulator ID REG0200 experimental
Regulator type protein
Regulatory pathway (from literatures) Global regulator
KEGG pathway (determined by BlastKOALA) -
Related T6SS T6SS00260 experimental (Type i3)
Strain Yersinia pseudotuberculosis YPIII
Replicon chromosome
Sequence Protein sequence (142 a.a.); Nucleotide sequence (426 bp)
Description ZntR regulator specifically recognizes, binds to, and activates the T6SS4 promoter.

External database links

Locus tag (Gene) YPK_RS01520 (ZntR)
Coordinates (Strand) 333471..333896 (+)
NCBI ID 488144494
RefSeq NC_010465
KEGG ID ypo:BZ17_2916, ypn:YPN_3833, ypy:YPK_0310, ypa:YPA_3237, ypi:YpsIP31758_3888, yps:YPTB3671
KEGG pathway (determined by BlastKOALA) -

Target Regulation (↓/↑) Target sequence
T6SS4 promoter catcctgatttacatacctgttataggttatagctattctctgttgtgataggttatagctattatgtctttatttttttcttatttaagaaataacctaggacaaaaaacagtagtagggataaacttattcgcagattttttcacccttcatacatttattaaatttacataaccattagcacgatgacgtggatgaatagccaaaataagaggacatagatatgagaaagaagctatataatgacttcgcgtgggaatgcctgaggcgaaatccacaatatattagcgattgggaattatttatgaaaaatactcttactaatggagggggtatacccgatgattctgaattaatccaatcagagctggatttgaatgcagaaaaaaaatggggagtaatgaaatatattgatccttataactctgacccaac putative ZntR binding region is indicated red

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
MerR_1 PF13411.8 7.4e-21 3..69

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9924 - -

  Protein sequence of regulator: 142 a.a.    .

>REG0200 NC_010465:333471-333896 [Yersinia pseudotuberculosis YPIII]

  Nucleotide sequence of regulator: 426 bp    .

>REG0200 NC_010465:333471-333896 [Yersinia pseudotuberculosis YPIII]