Detailed information of regulator


Regulator ID REG0188 experimental
Regulator type protein
Regulatory pathway (from literatures) (p)ppGpp regulatory pathway
KEGG pathway (determined by BlastKOALA) -
Related T6SS T6SS00260 experimental (Type i3)
Strain Yersinia pseudotuberculosis YPIII
Replicon chromosome
Sequence Protein sequence (144 a.a.); Nucleotide sequence (432 bp)
Description RovA positively regulates T6SS4 expression by recognizing two conserved AT-rich RovA-binding sites in the T6SS4 promoter.

External database links

Locus tag (Gene) YPK_1876 (RovA)
Coordinates (Strand) 2082384..2082815 (+)
NCBI ID 488139747
RefSeq NC_010465
KEGG ID ypl:CH46_2733, ypv:BZ15_1153, ypn:YPN_1831, ypi:YpsIP31758_1767, ypw:CH59_4203, ypo:BZ17_172, ype:YPO2374, ypk:y1961, ypj:CH55_448, ypy:YPK_1876, yps:YPTB2288, ypg:YpAngola_A2560, ypp:YPDSF_0772, ypm:YP_2160
KEGG pathway (determined by BlastKOALA) -

Target Regulation (↓/↑) Target sequence
T6SS-4 promoter region cctaggacaaaaaacagtagtagggataaacttattcgcagattttttcacccttcatacatttattaaatttacataaccattagcacgat
T6SS-4 promoter region tgatttataacctccctgtttgtatattttataatcatcctgatttacatacctgttat

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
MarR PF01047.24 4e-17 29..87

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9985 - -

  Protein sequence of regulator: 144 a.a.    .

>REG0188 NC_010465:2082384-2082815 [Yersinia pseudotuberculosis YPIII]

  Nucleotide sequence of regulator: 432 bp    .

>REG0188 NC_010465:2082384-2082815 [Yersinia pseudotuberculosis YPIII]