Detailed information of regulator


Regulator ID REG0171 experimental
Regulator type protein
Regulatory pathway (from literatures) Global regulator
KEGG pathway (determined by BlastKOALA) -
Related T6SS T6SS00155 insolico (Type i1)
Strain Escherichia coli APEC O1
Replicon chromosome
Sequence Protein sequence (251 a.a.); Nucleotide sequence (753 bp)
Description FNR direct regulates vgrG by binding to the promoter regions of vgrG.

External database links

Locus tag (Gene) APECO1_487 (FNR)
Coordinates (Strand) 1455411..1456163 (-)
NCBI ID 446534565
RefSeq NC_008563
KEGG ID ece:Z2433, eln:NRG857_06845, ecs:ECs1915, ecz:ECS88_1476, sfl:SF1836, elo:EC042_1451, elh:ETEC_1438, elw:ECW_m1431, ecm:EcSMS35_1788, sfx:S1434, esl:O3K_13655, eck:EC55989_1498, ecc:c1807, sft:NCTC1_01980, eum:ECUMN_1629, ecq:ECED1_1544, ect:ECIAI39_1683, ecg:E2348C_1527, ecj:JW1328, ecw:EcE24377A_1546, eco:b1334
KEGG pathway (determined by BlastKOALA) -

Target Regulation (↓/↑) Target sequence
APECO1_1756 (VgrG1) aaggttgagtgggagcacatcaaatccggtacttctggtgccgatgactggcgtgcaccgctggaagcataaatctgagtcaacaacatcctgcctccgtgcaggatgttgtttttgtacgtgtaaaaaatgagtgtcagtaaggagttacgctttcatgagggagatggtggatgccggaaacccgggcggtagcgtacctgaaaatgtaaagatgagtgtaacgctgcactggcaccctttgctgcatggtgggaatcatttggtccgtgaatgaatcagggaggtcattatgtccttaaaaggtcttcgctttacgctggaggttgacg

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
Crp PF00325.22 3.3e-16 193..224
cNMP_binding PF00027.31 1.4e-15 51..132

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9760 - -

  Protein sequence of regulator: 251 a.a.    .

>REG0171 NC_008563:c1456163-1455411 [Escherichia coli APEC O1]

  Nucleotide sequence of regulator: 753 bp    .

>REG0171 NC_008563:c1456163-1455411 [Escherichia coli APEC O1]