Detailed information of regulator


Regulator ID REG0154 experimental
Regulator type protein
Regulatory pathway (from literatures) Global regulator
KEGG pathway (determined by BlastKOALA) Quorum sensing (map02024)
Related T6SS T6SS00113 experimental (Type i1)
Strain Burkholderia thailandensis E264
Replicon chromosome
Sequence Protein sequence (155 a.a.); Nucleotide sequence (465 bp)
Description bth_I0691(Zur) in chromosome I directly represses expression of T6SS4 in chromosome II by interaction of T6SS4 promoter.

External database links

Locus tag (Gene) bth_I0691 (Zur)
Coordinates (Strand) 796074..796538 (-)
NCBI ID 497578547
RefSeq NC_007651
Uniprot ID UPI00016A4226
KEGG pathway (determined by BlastKOALA) map02024

Target Regulation (↓/↑) Target sequence
BTH_RS09735 (T6SS-4) Promotor,−541 to −1 relative to the ATG start codon ggtctatccacaaatcacaggcgttaggtaccgacttcgcaaaaccagattagcttgcgtcttgtcaaaatacccgaacttatttcttcgaatgtattagcgaccacataactcgatgccgaccatcagtcaaagcggcgtggggaattagattagtactagccggaaaaaggcaaacaaacgcccgcggcgtccgggaaaatattccacggaaaccgtttacgctgctgtttttttctcagtggtattaacccaccccttccgcccagcccgatccctgcgagtcggcatacgccggcttccgcaacggcaatcggtaagatgcactcccgctaaatcaaataccgcacgcgcataaatcgatgcgccgtcgcgatcgcggcggaaataacatccaagcaccgggtttatctgaagcgtcacaccttagtggccctcaacgacaacggcgtgacaatcgttcatatcgttacagtctacgctgtaaacttatagaacgctcgtaaatttggcaagcggaaataattttttcttacaaac Identification of a Zur binding site in the T6SS4 promoter region, indicated by red

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
FUR PF01475.21 7.2e-11 21..138

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9618 - -

  Protein sequence of regulator: 155 a.a.    .

>REG0154 NC_007651:c796538-796074 [Burkholderia thailandensis E264]

  Nucleotide sequence of regulator: 465 bp    .

>REG0154 NC_007651:c796538-796074 [Burkholderia thailandensis E264]