Detailed information of regulator


Regulator ID REG0153 experimental
Regulator type protein
Regulatory pathway (from literatures) Global regulator
KEGG pathway (determined by BlastKOALA) Biofilm formation - Escherichia coli (map02026)
Related T6SS T6SS00113 experimental (Type i1)
Strain Burkholderia thailandensis E264
Replicon chromosome
Sequence Protein sequence (320 a.a.); Nucleotide sequence (960 bp)
Description OxyR in chromosome I negatively regulates the expression of T6SS-4 in chromosome II by specifically recognizing an operator within the T6SS-4 promoter.

External database links

Locus tag (Gene) BTH_I1281 (OxyR)
Coordinates (Strand) 1432632..1433591 (+)
NCBI ID 497575020
RefSeq NC_007651
Uniprot ID Q2SZ21_BURTA
KEGG ID bte:BTH_I1281
KEGG pathway (determined by BlastKOALA) map02026

Target Regulation (↓/↑) Target sequence
BTH_RS09735 (T6SS-4) Promotor,−536 to −186 relative to the ATG start codon cggcgtccgggaaaatattccacggaaaccgtttacgctgctgtttttttctcagtggtattaacccaccccttccgcccagcccgatccctgcgagtcggcatacgccggcttccgcaacggcaatcggtaagatgcactcccgctaaatcaaataccgcacgcgcataaatcgatgcgccgtcgcgatcgcggcggaaataacatccaagcaccgggtttatctgaagcgtcacaccttagtggccctcaacgacaacggcgtgacaatcgttcatatcgttacagtctacgctgtaaacttatagaacgctcgtaaatttggcaagcggaaataattttttcttacaaac

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
LysR_substrate PF03466.22 3.2e-46 90..301
HTH_1 PF00126.29 3e-17 4..61

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9792 - -

  Protein sequence of regulator: 320 a.a.    .

>REG0153 NC_007651:1432632-1433591 [Burkholderia thailandensis E264]

  Nucleotide sequence of regulator: 960 bp    .

>REG0153 NC_007651:1432632-1433591 [Burkholderia thailandensis E264]