Detailed information of regulator


Regulator ID REG0065 experimental
Regulator type protein
Regulatory pathway (from literatures) Global regulator; QS regulatory pathway
KEGG pathway (determined by BlastKOALA) Quorum sensing (map02024); Biofilm formation - Pseudomonas aeruginosa (map02025)
Related T6SS T6SS00004 experimental (Type i1)
Strain Pseudomonas aeruginosa PAO1
Replicon chromosome
Sequence Protein sequence (240 a.a.); Nucleotide sequence (720 bp)
Description The expression of H2-T6SS was significantly delayed in the two QS mutants and complementation in trans of the lasR mutation in PAORTS2 with pBLasR, restored the H2-T6SS promotor activity almost to its wild type levels at the exponential phase.

External database links

Locus tag (Gene) PA1430 (LasR)
Coordinates (Strand) 1558171..1558890 (+)
NCBI ID 15596627
RefSeq NC_002516
KEGG ID pae:PA1430
KEGG pathway (determined by BlastKOALA) map02024; map02025
PDB ID 3IX4, 6D6A, 3IX8, 3IX3, 6D6N, 6MWZ, 6D6B, 6D6O, 6MWL, 2UV0, 3JPU, 6D6D, 6D6L, 6D6M, 6MWW, 4NG2, 6MWH, 6D6C, 6D6P

Target Regulation (↓/↑) Target sequence
H2-T6SS promotor P (hsiA2) AACTACCTGTTTTGGTAGGG a putative Las-Rhl box

Pfam domain hit(s) of regulator

Domain Pfam ID E-value Aligned region
Autoind_bind PF03472.17 1.3e-37 18..160
GerE PF00196.21 3.1e-22 176..231

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence

Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9926 - -

  Protein sequence of regulator: 240 a.a.    .

>REG0065 NC_002516:1558171-1558890 [Pseudomonas aeruginosa PAO1]

  Nucleotide sequence of regulator: 720 bp    .

>REG0065 NC_002516:1558171-1558890 [Pseudomonas aeruginosa PAO1]