Detailed information of effector


Summary

Effector ID EFF00563 experimental
Effector type -
Cognate immunity protein -
Related T6SS (Type) T6SS00466 experimental (Type ii)
Strain Francisella tularensis subsp. holarctica LVS
Replicon chromosome
Sequence Protein sequence (165 a.a.); Nucleotide sequence (495 bp)
Description -
Reference
experimental Experimental investigation has been performed.
insolico Bioinformatics investigation has been performed

External database links

Locus tag (Gene) FTT_1347 (VgrG)
Coordinates (Strand) 117678..118172 (-)
NCBI ID 89255560
RefSeq NC_007880
Uniprot ID UPI00004502EE
KEGG ID -
PDB ID -

Pfam domain hit(s)

Domain Pfam ID E-value Aligned region

Transmembrane helices

  • Transmembrane helices are predicted using TMHMM 2.0 software.

Prediction                 Region     Sequence
Outside 1-164 MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILLATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNAEGLDVNIKGSVTASIKGSTATMVG



Signal peptides
  • Sec/SPI: "standard" secretory signal peptides transported by the Sec translocon and cleaved by Signal Peptidase I (Lep).
  • Sec/SPII: lipoprotein signal peptides transported by the Sec translocon and cleaved by Signal Peptidase II (Lsp).
  • Tat/SPI: Tat signal peptides transported by the Tat translocon and cleaved by Signal Peptidase I (Lep).
Prediction        Probability Cleavage site Signal peptide sequence
Other 0.9898 - -



  Protein sequence: 165 a.a.    .

>EFF00563 NC_007880:c118172-117678 [Francisella tularensis subsp. holarctica LVS]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILLATKKSSIMLS
EDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNAEGLDVNIKGSVTASIKGSTA
TMVG*

  Nucleotide sequence: 495 bp    .

>EFF00563 NC_007880:c118172-117678 [Francisella tularensis subsp. holarctica LVS]
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAAAAGGCTGCAC
TACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAGCGCTGATAAACAAATAATTG
AAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTAGCTACTAAGAAATCAAGCATTATGCTTAGT
GAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTATACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTAT
TAATATAAAAAGCTCTGCTAATATAAATATTCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAG
CAGATGTAAACCTTAATGCTGAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGTATAAAAGGTTCTACAGCA
ACAATGGTTGGATAA