Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | O4D10_RS05725 | Genome accession | NZ_CP114795 |
| Coordinates | 1345395..1345514 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri strain CM-BD-sm | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1340395..1350514
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| O4D10_RS05705 (O4D10_05695) | pilC | 1340978..1342237 (-) | 1260 | WP_033836749.1 | type II secretion system F family protein | Machinery gene |
| O4D10_RS05710 (O4D10_05700) | comP | 1342582..1343010 (+) | 429 | WP_005921364.1 | pilin | Machinery gene |
| O4D10_RS05715 (O4D10_05705) | pilA2 | 1343107..1343520 (+) | 414 | WP_005921365.1 | pilin | Machinery gene |
| O4D10_RS05720 (O4D10_05710) | pilB | 1343562..1345298 (+) | 1737 | WP_386341199.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| O4D10_RS05725 (O4D10_05715) | pilB | 1345395..1345514 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| O4D10_RS05730 | - | 1345596..1345778 (+) | 183 | Protein_1131 | hypothetical protein | - |
| O4D10_RS05735 (O4D10_05720) | pilR | 1345964..1347418 (-) | 1455 | WP_033484414.1 | sigma-54 dependent transcriptional regulator | Regulator |
| O4D10_RS05740 (O4D10_05725) | - | 1347683..1349296 (-) | 1614 | WP_386341202.1 | sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=767152 O4D10_RS05725 WP_005915819.1 1345395..1345514(+) (pilB) [Xanthomonas citri pv. citri strain CM-BD-sm]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=767152 O4D10_RS05725 WP_005915819.1 1345395..1345514(+) (pilB) [Xanthomonas citri pv. citri strain CM-BD-sm]
ATGCAGATCGCCGAGGCCGCGCAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGCTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGCCGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCGCAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGCTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGCCGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |