Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QNK02_RS02150 Genome accession   NZ_CP126083
Coordinates   424058..424180 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain C1_9     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 419058..429180
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QNK02_RS02135 (QNK02_02135) yclJ 420671..421354 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QNK02_RS02140 (QNK02_02140) yclK 421341..422762 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QNK02_RS02145 (QNK02_02145) rapC 422926..424074 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QNK02_RS02150 (QNK02_02150) phrC 424058..424180 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QNK02_RS02155 (QNK02_02155) yczM 424280..424369 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QNK02_RS02160 (QNK02_02160) yczN 424451..424564 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  QNK02_RS02165 (QNK02_02165) thrD 424717..426081 (-) 1365 WP_041850695.1 aspartate kinase -
  QNK02_RS02170 (QNK02_02170) ceuB 426466..427416 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QNK02_RS02175 (QNK02_02175) yclO 427409..428356 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  QNK02_RS02180 (QNK02_02180) yclP 428350..429108 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=766608 QNK02_RS02150 WP_003224994.1 424058..424180(+) (phrC) [Bacillus subtilis strain C1_9]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=766608 QNK02_RS02150 WP_003224994.1 424058..424180(+) (phrC) [Bacillus subtilis strain C1_9]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1