NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	K8B76_RS09415	Genome accession	NZ_CP082820
Coordinates	1874701..1875003 (-)	Length	100 a.a.
NCBI ID	WP_000413382.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain SCAID PHRX1-2021
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1869701..1880003

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
K8B76_RS09385 (K8B76_09385)	rnpA	1870381..1870752 (-)	372	WP_000739246.1	ribonuclease P protein component	-
K8B76_RS10890	-	1870769..1870900 (-)	132	WP_000768904.1	hypothetical protein	-
K8B76_RS09390 (K8B76_09390)	-	1870901..1872091 (-)	1191	WP_000167769.1	acetate kinase	-
K8B76_RS09395 (K8B76_09395)	comYH	1872142..1873095 (-)	954	WP_000345080.1	class I SAM-dependent methyltransferase	Machinery gene
K8B76_RS09400 (K8B76_09400)	-	1873156..1873750 (-)	595	Protein_1851	class I SAM-dependent methyltransferase	-
K8B76_RS09405 (K8B76_09405)	comGG/cglG	1873853..1874299 (-)	447	WP_001842224.1	competence type IV pilus minor pilin ComGG	Machinery gene
K8B76_RS09410 (K8B76_09410)	comGF/cglF	1874277..1874738 (-)	462	WP_000250539.1	competence type IV pilus minor pilin ComGF	Machinery gene
K8B76_RS09415 (K8B76_09415)	comGE/cglE	1874701..1875003 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
K8B76_RS09420 (K8B76_09420)	comGD/cglD	1874966..1875370 (-)	405	WP_000588030.1	competence type IV pilus minor pilin ComGD	Machinery gene
K8B76_RS09425 (K8B76_09425)	comGC/cglC	1875363..1875689 (-)	327	WP_000738625.1	competence type IV pilus major pilin ComGC	Machinery gene
K8B76_RS09430 (K8B76_09430)	comGB/cglB	1875691..1876707 (-)	1017	WP_078102766.1	competence type IV pilus assembly protein ComGB	Machinery gene
K8B76_RS09435 (K8B76_09435)	comGA/cglA/cilD	1876655..1877596 (-)	942	WP_000249571.1	competence type IV pilus ATPase ComGA	Machinery gene
K8B76_RS09440 (K8B76_09440)	-	1877672..1878037 (-)	366	WP_000286415.1	DUF1033 family protein	-
K8B76_RS09445 (K8B76_09445)	-	1878188..1879246 (-)	1059	WP_000649470.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11108.08 Da Isoelectric Point: 9.7273

                                >NTDB_id=602571 K8B76_RS09415 WP_000413382.1 1874701..1875003(-) (comGE/cglE) [Streptococcus pneumoniae strain SCAID PHRX1-2021]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=602571 K8B76_RS09415 WP_000413382.1 1874701..1875003(-) (comGE/cglE) [Streptococcus pneumoniae strain SCAID PHRX1-2021]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4

Detailed information NTG0602571