Detailed information    

insolico Bioinformatically predicted

Overview

Name   comA/nlmT   Type   Regulator
Locus tag   ST90730_RS08070 Genome accession   NZ_CP065481
Coordinates   1558856..1559011 (-) Length   51 a.a.
NCBI ID   WP_309252056.1    Uniprot ID   -
Organism   Streptococcus thermophilus strain 90730     
Function   transport of ComC (predicted from homology)   
Competence regulation

Genomic Context

Location: 1553856..1564011
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ST90730_RS08025 (ST90730_08035) nusB 1554305..1554739 (-) 435 WP_002951890.1 transcription antitermination factor NusB -
  ST90730_RS08030 (ST90730_08040) - 1554732..1555121 (-) 390 WP_002951891.1 Asp23/Gls24 family envelope stress response protein -
  ST90730_RS08035 (ST90730_08045) efp 1555192..1555752 (-) 561 WP_011227545.1 elongation factor P -
  ST90730_RS08040 (ST90730_08050) - 1555865..1556320 (-) 456 WP_002951893.1 deaminase -
  ST90730_RS08045 (ST90730_08055) - 1556339..1557400 (-) 1062 WP_011227546.1 Xaa-Pro peptidase family protein -
  ST90730_RS08050 (ST90730_08060) - 1557589..1558017 (-) 429 WP_002946567.1 hypothetical protein -
  ST90730_RS08055 - 1558086..1558217 (-) 132 WP_260214715.1 hypothetical protein -
  ST90730_RS08060 - 1558244..1558468 (-) 225 WP_347106870.1 hypothetical protein -
  ST90730_RS08065 - 1558623..1558829 (-) 207 WP_250637332.1 ATP-binding cassette domain-containing protein -
  ST90730_RS08070 comA/nlmT 1558856..1559011 (-) 156 WP_309252056.1 ATP-binding cassette domain-containing protein Regulator
  ST90730_RS08075 (ST90730_08075) - 1559199..1559390 (-) 192 WP_002946571.1 hypothetical protein -
  ST90730_RS08080 (ST90730_08080) - 1559552..1559824 (-) 273 WP_002946573.1 DUF3923 family protein -
  ST90730_RS08085 (ST90730_08085) uvrA 1559918..1562743 (-) 2826 WP_011227549.1 excinuclease ABC subunit UvrA Machinery gene
  ST90730_RS08090 (ST90730_08090) - 1563052..1563996 (+) 945 WP_347106872.1 magnesium transporter CorA family protein -

Sequence

Protein


Download         Length: 51 a.a.        Molecular weight: 5307.25 Da        Isoelectric Point: 10.6194

>NTDB_id=447835 ST90730_RS08070 WP_309252056.1 1558856..1559011(-) (comA/nlmT) [Streptococcus thermophilus strain 90730]
MDNISLTLKKGNIAGLIGNNGAGKTTLMKLISGILERPNGTIDLNTKTVVP

Nucleotide


Download         Length: 156 bp        

>NTDB_id=447835 ST90730_RS08070 WP_309252056.1 1558856..1559011(-) (comA/nlmT) [Streptococcus thermophilus strain 90730]
TTGGATAATATCTCTCTAACCTTGAAAAAGGGGAATATTGCTGGTCTGATTGGCAATAATGGTGCAGGAAAGACGACCTT
AATGAAATTAATTTCGGGTATCTTAGAGAGACCTAATGGAACTATTGACTTAAATACTAAAACTGTGGTGCCTTGA

Domains

Predicted by InterProScan.

ABC transporter (ABC_tran)

(2-48)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comA/nlmT Streptococcus mutans UA159

42.222

88.235

0.373