Detailed information
Overview
| Name | comYE | Type | Machinery gene |
| Locus tag | GO995_RS01040 | Genome accession | NZ_CP046624 |
| Coordinates | 166746..167039 (+) | Length | 97 a.a. |
| NCBI ID | WP_157628645.1 | Uniprot ID | - |
| Organism | Streptococcus ruminicola strain CNU_G3 | ||
| Function | dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 161746..172039
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| GO995_RS01015 (GO995_01015) | - | 163735..164103 (+) | 369 | WP_157628640.1 | DUF1033 family protein | - |
| GO995_RS01020 (GO995_01020) | comYA | 164176..165117 (+) | 942 | WP_157628641.1 | competence type IV pilus ATPase ComGA | Machinery gene |
| GO995_RS01025 (GO995_01025) | comYB | 165041..166084 (+) | 1044 | WP_202913541.1 | competence type IV pilus assembly protein ComGB | Machinery gene |
| GO995_RS01030 (GO995_01030) | comYC | 166084..166386 (+) | 303 | WP_157628643.1 | competence type IV pilus major pilin ComGC | Machinery gene |
| GO995_RS01035 (GO995_01035) | comYD | 166361..166792 (+) | 432 | WP_157628644.1 | competence type IV pilus minor pilin ComGD | Machinery gene |
| GO995_RS01040 (GO995_01040) | comYE | 166746..167039 (+) | 294 | WP_157628645.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
| GO995_RS01045 (GO995_01045) | comYF | 167023..167460 (+) | 438 | WP_157628646.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| GO995_RS01050 (GO995_01050) | comGG | 167432..167782 (+) | 351 | WP_133018088.1 | competence type IV pilus minor pilin ComGG | - |
| GO995_RS01055 (GO995_01055) | comYH | 167836..168792 (+) | 957 | WP_006531743.1 | class I SAM-dependent methyltransferase | Machinery gene |
| GO995_RS01060 (GO995_01060) | - | 168846..170045 (+) | 1200 | WP_039697418.1 | acetate kinase | - |
| GO995_RS01065 (GO995_01065) | - | 170204..170401 (+) | 198 | WP_074561137.1 | helix-turn-helix transcriptional regulator | - |
| GO995_RS01070 (GO995_01070) | - | 170417..170617 (+) | 201 | WP_157628647.1 | hypothetical protein | - |
| GO995_RS01075 (GO995_01075) | - | 170618..171073 (+) | 456 | WP_238385877.1 | ABC transporter permease | - |
| GO995_RS01080 (GO995_01080) | - | 171089..171724 (+) | 636 | WP_157628648.1 | CPBP family intramembrane glutamic endopeptidase | - |
Sequence
Protein
Download Length: 97 a.a. Molecular weight: 10774.53 Da Isoelectric Point: 6.4778
>NTDB_id=406143 GO995_RS01040 WP_157628645.1 166746..167039(+) (comYE) [Streptococcus ruminicola strain CNU_G3]
MVTIKKQKLKAYILLEGLVALALLATITSLVLGEMDHSRTQMQESLHQQEVLNVATMAVQTGQDHLAINGVEVRMVKYDN
AISIYDGQNEVLHVTKN
MVTIKKQKLKAYILLEGLVALALLATITSLVLGEMDHSRTQMQESLHQQEVLNVATMAVQTGQDHLAINGVEVRMVKYDN
AISIYDGQNEVLHVTKN
Nucleotide
Download Length: 294 bp
>NTDB_id=406143 GO995_RS01040 WP_157628645.1 166746..167039(+) (comYE) [Streptococcus ruminicola strain CNU_G3]
GTGGTAACTATAAAAAAACAGAAACTAAAAGCTTACATACTCCTTGAGGGGTTAGTAGCACTAGCCTTATTAGCAACGAT
AACCAGTTTGGTCTTAGGAGAAATGGACCATAGTCGCACTCAAATGCAAGAGAGTTTGCATCAGCAAGAAGTACTTAATG
TAGCGACCATGGCCGTTCAAACAGGACAAGACCATTTGGCCATTAATGGGGTTGAGGTGCGTATGGTTAAGTATGATAAT
GCGATTTCCATTTATGATGGGCAAAACGAGGTGCTACATGTCACGAAAAATTAG
GTGGTAACTATAAAAAAACAGAAACTAAAAGCTTACATACTCCTTGAGGGGTTAGTAGCACTAGCCTTATTAGCAACGAT
AACCAGTTTGGTCTTAGGAGAAATGGACCATAGTCGCACTCAAATGCAAGAGAGTTTGCATCAGCAAGAAGTACTTAATG
TAGCGACCATGGCCGTTCAAACAGGACAAGACCATTTGGCCATTAATGGGGTTGAGGTGCGTATGGTTAAGTATGATAAT
GCGATTTCCATTTATGATGGGCAAAACGAGGTGCTACATGTCACGAAAAATTAG
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comYE | Streptococcus mutans UA140 |
51.042 |
98.969 |
0.505 |
| comYE | Streptococcus mutans UA159 |
51.042 |
98.969 |
0.505 |
| comGE/cglE | Streptococcus pneumoniae Rx1 |
41.304 |
94.845 |
0.392 |
| comGE/cglE | Streptococcus pneumoniae D39 |
41.304 |
94.845 |
0.392 |
| comGE/cglE | Streptococcus pneumoniae R6 |
41.304 |
94.845 |
0.392 |
| comGE/cglE | Streptococcus pneumoniae TIGR4 |
41.304 |
94.845 |
0.392 |
| comGE/cglE | Streptococcus mitis SK321 |
40.217 |
94.845 |
0.381 |
| comGE/cglE | Streptococcus mitis NCTC 12261 |
40.217 |
94.845 |
0.381 |