Detailed information    

experimental Experimentally validated

Overview


Name   comM   Type   Regulator
Locus tag   KZH43_RS08690 Genome accession   NZ_CP079923
Coordinates   1721168..1721789 (-) Length   206 a.a.
NCBI ID   Protein_1730    Uniprot ID   -
Organism   Streptococcus pneumoniae Rx1     
Function   fratricide immunity   
Competence regulation

Function


The comM gene encodes a protein that provides cellular immunity towards lytic enzymes, such as the murein hydrolase CbpD, which is involved in fratricide during competence. ComM protects competent cells from the lytic enzymes produced during the competence state, allowing them to survive and undergo natural transformation.


Genomic Context


Location: 1716168..1726789
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KZH43_RS08665 (KZH43_08660) recA 1716545..1717711 (-) 1167 WP_001085462.1 recombinase RecA Machinery gene
  KZH43_RS08670 (KZH43_08665) cinA 1717766..1719022 (-) 1257 WP_000642700.1 competence/damage-inducible protein A Machinery gene
  KZH43_RS08675 (KZH43_08670) - 1719107..1720123 (-) 1017 WP_000239282.1 LCP family protein -
  KZH43_RS08680 (KZH43_08675) - 1720131..1720649 (-) 519 WP_000455537.1 GNAT family N-acetyltransferase -
  KZH43_RS08685 (KZH43_08680) tsaE 1720639..1721082 (-) 444 WP_000288232.1 tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE -
  KZH43_RS08690 (KZH43_08685) comM 1721168..1721789 (-) 622 Protein_1730 hypothetical protein Regulator
  KZH43_RS08695 (KZH43_08690) - 1722172..1723035 (-) 864 WP_001093641.1 helix-turn-helix domain-containing protein -
  KZH43_RS10705 - 1723227..1723397 (+) 171 WP_001227862.1 PhrA family quorum-sensing system peptide -
  KZH43_RS08700 (KZH43_08695) pneA1 1723500..1723724 (+) 225 WP_000181087.1 two-peptide bacteriocin subunit PneA1 -
  KZH43_RS08705 (KZH43_08700) pneA2 1723731..1723919 (+) 189 WP_000786759.1 two-peptide bacteriocin subunit PneA2 -

Regulatory network


Positive effect      
Negative effect
Regulator Target Regulation
  comM cbpD negative effect
  cbpD lytA positive effect
  cbpD lytC positive effect
  comE comM positive effect
  comE comA positive effect
  comA comC/comC1 positive effect
  comE comB positive effect
  comB comC/comC1 positive effect
  comE comE positive effect
  comE comC/comC1 positive effect
  comE comX/comX1 positive effect
  comE comX/comX2 positive effect
  comE comD/comD1 positive effect
  comE comW positive effect
  comD/comD1 comE positive effect
  stkP comE positive effect
  comC/comC1 comD/comD1 positive effect
  ciaR comC/comC1 negative effect
  ciaH comC/comC1 negative effect
  htrA comC/comC1 negative effect
  comX/comX1 late competence genes positive effect
  comW comX/comX1 positive effect
  clpE comX/comX1 negative effect
  clpP comX/comX1 negative effect
  comX/comX2 late competence genes positive effect
  comW comX/comX2 positive effect
  clpE comX/comX2 negative effect
  clpP comX/comX2 negative effect
  clpC comW negative effect
  clpP comW negative effect
  mecA comW negative effect
  ciaR htrA positive effect
  ciaH htrA positive effect
  htrA comEA/celA/cilE negative effect
  htrA comEC/celB negative effect
  comX/comX1 late competence genes positive effect
  comX/comX2 late competence genes positive effect

Sequence


Protein


Download         Length: 206 a.a.        Molecular weight: Da        Isoelectric Point:

>NTDB_id=253 KZH43_RS08690 Protein_1730 1721168..1721789(-) (comM) [Streptococcus pneumoniae Rx1]
None

Nucleotide


Download         Length: 622 bp        

>NTDB_id=253 KZH43_RS08690 Protein_1730 1721168..1721789(-) (comM) [Streptococcus pneumoniae Rx1]
ATGAAATCAATGAGAATCTTATTTTTGTTAGCTTTAATTCAAATCAGTTTGAGTAGCTGTTTCCTATGGAAGGAATGCAT
CTTGTCCTTTAAACAAAGTACAGCTTTTTTCATCGGAAGCATGGTTTTCGTTTCAGGAATCTGTGCTGGAGTAAATTATC
TTTATACCCGTAAGCAAGAAGTCCATAGTGTCCTAGCCAGTAAGAAGTCGGTGAAGCTTTTTTACAGTATGTTACTCTTA
ATTAATTTGTTAGGAGCTGTTCTTGTTTTGTCAGATAACTTGTTCATCAAAAATACGCTGCAGCAAGAATTAGTTGACTT
TTTATTGCCATCCTTCTTTTTCCTATTTGGGCTAGATTTGCTGATTTTTTTTACCCTTGAAAAAATACGTGCGCGATTTT
CTTGCTATGCTGGACAGAAAAAAGACAGTGTTGGTGACTATTTTAGCAACACTTCTTTTCTTAAGAAATCCAATGACCAT
TGTCTCACTTCTGATTTATATTGGACTGGGCTTGTTTTTTGCAGCCTATCTTGTCCCAAATTCGGTTAAGAAGGAAGTTT
CCTTTTATGGTCATATTTTCCGAGATCTTGTATTGGTCATTGTTACGCTCATTTTCTTTTAG

Domains



No domain identified.



Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value

References


[1] Daniel Straume et al. (2017) Overexpression of the fratricide immunity protein ComM leads to growth inhibition and morphological abnormalities in Streptococcus pneumoniae. Microbiology (Reading, England) 163(1):9-21. [PMID: 27902435]
[2] Leiv Sigve Håvarstein et al. (2006) New insights into the pneumococcal fratricide: relationship to clumping and identification of a novel immunity factor. Molecular Microbiology 59(4):1297-307. [PMID: 16430701]
[3] Scott N Peterson et al. (2004) Identification of competence pheromone responsive genes in Streptococcus pneumoniae by use of DNA microarrays. Molecular Microbiology 51(4):1051-70. [PMID: 14763980]