Detailed information NTG0185416

Bioinformatically predicted

Overview

• Name: prx
• Type: Regulator
• Locus tag: A9497_RS11805
• Genome accession: NZ_CP016026
• Coordinates: 1055222..1055314 (-)
• Length: 30 a.a.
• NCBI ID: WP_418346448.1
• Uniprot ID: -
• Organism: Streptococcus thermophilus strain KLDS SM
• Function: Inhibit ComR activation (predicted from homology) Competence regulation

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
IS/Tn	1055459..1056634	1055222..1055314	flank	145

Gene organization within MGE regions

Location: 1055222..1056634

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
A9497_RS11805	prx	1055222..1055314 (-)	93	WP_418346448.1	hypothetical protein	Regulator
A9497_RS05385 (A9497_05385)	-	1055459..1056634 (+)	1176	WP_011681068.1	IS256 family transposase	-

Sequence

Protein

• Length: 30 a.a.
• Molecular weight: 3454.91 Da
• Isoelectric Point: 8.9001

>NTDB_id=185416 A9497_RS11805 WP_418346448.1 1055222..1055314(-) (prx) [Streptococcus thermophilus strain KLDS SM]
MKGDTVQIVRKNGKIHDNVLDGERVEHTKH

Nucleotide

• Length: 93 bp

>NTDB_id=185416 A9497_RS11805 WP_418346448.1 1055222..1055314(-) (prx) [Streptococcus thermophilus strain KLDS SM]
ATTAAAGGTGATACTGTCCAGATTGTCCGAAAGAATGGTAAGATCCATGACAACGTTTTAGACGGTGAACGAGTTGAGCA
CACGAAACATTGA

Domains

No domain identified.

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
prx	Streptococcus pyogenes MGAS315	65.385	86.667	0.567
prx	Streptococcus pyogenes MGAS315	73.913	76.667	0.567
prx	Streptococcus pyogenes MGAS8232	55.556	90	0.5
prx	Streptococcus pyogenes MGAS315	60	83.333	0.5
prx	Streptococcus pyogenes MGAS315	60	83.333	0.5
prx	Streptococcus pyogenes MGAS315	77.778	60	0.467
prx	Streptococcus pyogenes MGAS315	51.852	90	0.467