Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ABHI23_RS16340 | Genome accession | NZ_CP156913 |
| Coordinates | 3838902..3839021 (-) | Length | 39 a.a. |
| NCBI ID | WP_033482837.1 | Uniprot ID | - |
| Organism | Xanthomonas citri pv. mangiferaeindicae strain CFBP 1716 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 3833902..3844021
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ABHI23_RS16325 (ABHI23_16330) | - | 3835081..3836694 (+) | 1614 | WP_003488599.1 | PAS domain-containing sensor histidine kinase | - |
| ABHI23_RS16330 (ABHI23_16335) | pilR | 3837023..3838417 (+) | 1395 | WP_003488597.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ABHI23_RS16335 (ABHI23_16340) | - | 3838615..3838770 (-) | 156 | WP_003488595.1 | hypothetical protein | - |
| ABHI23_RS16340 (ABHI23_16345) | pilB | 3838902..3839021 (-) | 120 | WP_033482837.1 | hypothetical protein | Machinery gene |
| ABHI23_RS16345 (ABHI23_16350) | pilB | 3839118..3840854 (-) | 1737 | WP_033482835.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ABHI23_RS16350 | - | 3840896..3841099 (-) | 204 | WP_386266589.1 | hypothetical protein | - |
| ABHI23_RS16355 (ABHI23_16355) | - | 3841149..3842111 (-) | 963 | WP_103791079.1 | IS1595-like element IS1595 family transposase | - |
| ABHI23_RS16360 (ABHI23_16360) | pilA2 | 3842199..3842390 (-) | 192 | WP_157380112.1 | prepilin-type N-terminal cleavage/methylation domain-containing protein | Machinery gene |
| ABHI23_RS16365 (ABHI23_16365) | comP | 3842487..3842915 (-) | 429 | WP_005921364.1 | pilin | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4205.86 Da Isoelectric Point: 9.0113
>NTDB_id=1003191 ABHI23_RS16340 WP_033482837.1 3838902..3839021(-) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain CFBP 1716]
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1003191 ABHI23_RS16340 WP_033482837.1 3838902..3839021(-) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain CFBP 1716]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
48.718 |
100 |
0.487 |
| pilB | Acinetobacter baumannii D1279779 |
46.154 |
100 |
0.462 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilB | Vibrio cholerae strain A1552 |
42.857 |
89.744 |
0.385 |