Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   PPM34_RS01545 Genome accession   NZ_CP116869
Coordinates   301819..301941 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain MGP001     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 296819..306941
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PPM34_RS01530 yclJ 298433..299116 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  PPM34_RS01535 yclK 299103..300524 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  PPM34_RS01540 rapC 300687..301835 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  PPM34_RS01545 phrC 301819..301941 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  PPM34_RS01550 yczM 302041..302130 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  PPM34_RS01555 yczN 302212..302325 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  PPM34_RS01560 thrD 302479..303843 (-) 1365 WP_009966541.1 aspartate kinase -
  PPM34_RS01565 ceuB 304228..305178 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  PPM34_RS01570 yclO 305171..306118 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  PPM34_RS01575 yclP 306112..306870 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=713631 PPM34_RS01545 WP_003224994.1 301819..301941(+) (phrC) [Bacillus subtilis subsp. subtilis strain MGP001]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=713631 PPM34_RS01545 WP_003224994.1 301819..301941(+) (phrC) [Bacillus subtilis subsp. subtilis strain MGP001]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1