Detailed information
Bioinformatically predicted
Overview
| Name | comA | Type | Regulator |
| Locus tag | SR187_RS10195 | Genome accession | NZ_AP018400 |
| Coordinates | 950202..950315 (+) | Length | 37 a.a. |
| NCBI ID | WP_407697564.1 | Uniprot ID | A0A2Z5TML3 |
| Organism | Streptococcus ruminantium strain GUT-187 | ||
| Function | processing and transport of ComC (predicted from homology) Competence regulation |
||
Genomic Context
Location: 945202..955315
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SR187_RS04605 (SR187_4715) | - | 945949..946542 (+) | 594 | WP_120171657.1 | PBECR4 domain-containing protein | - |
| SR187_RS04610 (SR187_4720) | - | 946813..946971 (+) | 159 | Protein_850 | putative cross-wall-targeting lipoprotein signal domain-containing proteiin | - |
| SR187_RS10050 (SR187_4725) | - | 947132..947560 (+) | 429 | WP_231996451.1 | glycosyltransferase | - |
| SR187_RS10185 | - | 947586..947642 (+) | 57 | Protein_852 | hypothetical protein | - |
| SR187_RS04620 | - | 948824..949015 (+) | 192 | WP_105141509.1 | hypothetical protein | - |
| SR187_RS10190 (SR187_4730) | comA | 949218..949562 (+) | 345 | WP_269460238.1 | cysteine peptidase family C39 domain-containing protein | Regulator |
| SR187_RS10195 (SR187_4740) | comA | 950202..950315 (+) | 114 | WP_407697564.1 | hypothetical protein | Regulator |
| SR187_RS10200 (SR187_4745) | comA | 951036..951326 (+) | 291 | WP_269460240.1 | ATP-binding cassette domain-containing protein | Regulator |
| SR187_RS04630 (SR187_4750) | - | 951348..951503 (+) | 156 | WP_120171658.1 | bacteriocin-type signal sequence | - |
| SR187_RS04635 (SR187_4755) | - | 951944..952792 (+) | 849 | WP_231996452.1 | GHKL domain-containing protein | - |
| SR187_RS10055 (SR187_4760) | - | 952807..953049 (+) | 243 | WP_231996453.1 | hypothetical protein | - |
| SR187_RS04645 (SR187_4765) | - | 954114..954749 (+) | 636 | WP_120171659.1 | hypothetical protein | - |
Sequence
Protein
Download Length: 37 a.a. Molecular weight: 4053.68 Da Isoelectric Point: 4.7719
>NTDB_id=69471 SR187_RS10195 WP_407697564.1 950202..950315(+) (comA) [Streptococcus ruminantium strain GUT-187]
MEAGASLSSVLIEDINGIETIKSLTSEVDRYKKIKTI
MEAGASLSSVLIEDINGIETIKSLTSEVDRYKKIKTI
Nucleotide
Download Length: 114 bp
>NTDB_id=69471 SR187_RS10195 WP_407697564.1 950202..950315(+) (comA) [Streptococcus ruminantium strain GUT-187]
ATGGAAGCAGGAGCTTCACTTTCCTCAGTTCTTATAGAAGATATAAATGGAATAGAGACAATAAAATCTCTTACTAGTGA
GGTTGATCGCTATAAAAAAATAAAGACAATTTAG
ATGGAAGCAGGAGCTTCACTTTCCTCAGTTCTTATAGAAGATATAAATGGAATAGAGACAATAAAATCTCTTACTAGTGA
GGTTGATCGCTATAAAAAAATAAAGACAATTTAG
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comA | Streptococcus mitis NCTC 12261 |
79.412 |
91.892 |
0.73 |
| comA | Streptococcus pneumoniae Rx1 |
79.412 |
91.892 |
0.73 |
| comA | Streptococcus pneumoniae D39 |
79.412 |
91.892 |
0.73 |
| comA | Streptococcus pneumoniae R6 |
79.412 |
91.892 |
0.73 |
| comA | Streptococcus mitis SK321 |
79.412 |
91.892 |
0.73 |
| comA | Streptococcus pneumoniae TIGR4 |
79.412 |
91.892 |
0.73 |
| comA | Streptococcus gordonii str. Challis substr. CH1 |
76.471 |
91.892 |
0.703 |
| comA/nlmT | Streptococcus mutans UA159 |
67.647 |
91.892 |
0.622 |