NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	M9H69_RS01195	Genome accession	NZ_CP097843
Coordinates	214019..214321 (+)	Length	100 a.a.
NCBI ID	WP_167266658.1	Uniprot ID	-
Organism	Streptococcus oralis strain HP01
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 209019..219321

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
M9H69_RS01165 (M9H69_01165)	nagA	209694..210845 (+)	1152	WP_084876957.1	N-acetylglucosamine-6-phosphate deacetylase	-
M9H69_RS01170 (M9H69_01170)	-	210999..211364 (+)	366	WP_000286396.1	DUF1033 family protein	-
M9H69_RS01175 (M9H69_01175)	comGA/cglA/cilD	211429..212370 (+)	942	WP_213988900.1	competence type IV pilus ATPase ComGA	Machinery gene
M9H69_RS01180 (M9H69_01180)	comGB/cglB	212318..213334 (+)	1017	WP_213988901.1	competence type IV pilus assembly protein ComGB	Machinery gene
M9H69_RS01185 (M9H69_01185)	comGC/cglC	213336..213659 (+)	324	WP_000735798.1	competence type IV pilus major pilin ComGC	Machinery gene
M9H69_RS01190 (M9H69_01190)	comGD/cglD	213622..214056 (+)	435	WP_250315697.1	competence type IV pilus minor pilin ComGD	Machinery gene
M9H69_RS01195 (M9H69_01195)	comGE/cglE	214019..214321 (+)	303	WP_167266658.1	competence type IV pilus minor pilin ComGE	Machinery gene
M9H69_RS01200 (M9H69_01200)	comGF/cglF	214284..214745 (+)	462	WP_000250702.1	competence type IV pilus minor pilin ComGF	Machinery gene
M9H69_RS01205 (M9H69_01205)	comGG/cglG	214723..215136 (+)	414	WP_195217483.1	competence type IV pilus minor pilin ComGG	Machinery gene
M9H69_RS01210 (M9H69_01210)	-	215169..215759 (+)	591	WP_250315698.1	class I SAM-dependent methyltransferase	-
M9H69_RS01215 (M9H69_01215)	comYH	215818..216765 (+)	948	WP_250315699.1	class I SAM-dependent methyltransferase	Machinery gene
M9H69_RS01220 (M9H69_01220)	-	216823..218013 (+)	1191	WP_250315700.1	acetate kinase	-
M9H69_RS01225 (M9H69_01225)	rnpA	218162..218533 (+)	372	WP_000748120.1	ribonuclease P protein component	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11193.19 Da Isoelectric Point: 8.5846

                                >NTDB_id=692901 M9H69_RS01195 WP_167266658.1 214019..214321(+) (comGE/cglE) [Streptococcus oralis strain HP01]

MEKLNALRKQKIKAVILLEALVALAIFASIATLLLGQIQQNRRLEAEILQKEEVLRVAKMALQTGQNQVNINGVEIQVFA

SEKGLEVYHGSEKLLDLKEQ

Nucleotide

Download Length: 303 bp

                                >NTDB_id=692901 M9H69_RS01195 WP_167266658.1 214019..214321(+) (comGE/cglE) [Streptococcus oralis strain HP01]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAAGGCAGTGATTTTACTGGAAGCGTTGGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTTCTTTTGGGACAAATCCAACAAAATCGACGGTTAGAGGCAGAAATCTTGCAAAAGGAAGAAG

TCTTGCGTGTGGCGAAGATGGCTCTGCAAACAGGGCAAAATCAGGTAAACATAAATGGAGTTGAGATTCAGGTATTTGCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAGAAATTGCTCGATCTTAAAGAGCAGTAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-96)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus mitis NCTC 12261	88.889	99	0.88
comGE/cglE	Streptococcus pneumoniae Rx1	88.889	99	0.88
comGE/cglE	Streptococcus pneumoniae D39	88.889	99	0.88
comGE/cglE	Streptococcus pneumoniae R6	88.889	99	0.88
comGE/cglE	Streptococcus pneumoniae TIGR4	88.889	99	0.88
comGE/cglE	Streptococcus mitis SK321	87.879	99	0.87
comYE	Streptococcus mutans UA140	44.565	92	0.41
comYE	Streptococcus mutans UA159	44.565	92	0.41

Detailed information NTG0692901