Detailed information
Experimentally validated
Overview
| Name | ccnE | Type | Regulator |
| Locus tag | - | Genome accession | NC_003098 |
| Coordinates | 212277..212427 (+) | Length | 50.3333333333333 a.a. |
| NCBI ID | - | Uniprot ID | - |
| Organism | Streptococcus pneumoniae R6 | ||
| Function | repress competence development Competence regulation |
||
Genomic Context
Location: 207277..217427
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SPR_RS01120 (spr0211) | infA | 207825..208043 (+) | 219 | WP_001029883.1 | translation initiation factor IF-1 | - |
| SPR_RS01125 (spr0212) | rpmJ | 208068..208184 (+) | 117 | WP_001808836.1 | 50S ribosomal protein L36 | - |
| SPR_RS01130 (spr0213) | rpsM | 208202..208567 (+) | 366 | WP_000090781.1 | 30S ribosomal protein S13 | - |
| SPR_RS01135 (spr0214) | rpsK | 208585..208968 (+) | 384 | WP_001118385.1 | 30S ribosomal protein S11 | - |
| SPR_RS01140 (spr0215) | - | 209011..209946 (+) | 936 | WP_000568988.1 | DNA-directed RNA polymerase subunit alpha | - |
| SPR_RS01145 (spr0216) | rplQ | 209958..210344 (+) | 387 | WP_000331493.1 | 50S ribosomal protein L17 | - |
| SPR_RS01150 (spr0217) | - | 210609..210875 (+) | 267 | WP_000644124.1 | ACT domain-containing protein | - |
| SPR_RS01155 (spr0218) | - | 210885..212222 (+) | 1338 | WP_000354918.1 | PFL family protein | - |
| - | ccnE | 212277..212427 (+) | 151 | - | - | Regulator |
| SPR_RS01160 (spr0219) | - | 212466..213158 (+) | 693 | WP_000241540.1 | histidine phosphatase family protein | - |
| SPR_RS01165 | - | 213261..214906 (-) | 1646 | Protein_229 | ABC transporter permease | - |
| SPR_RS01170 (spr0222) | - | 214896..215987 (-) | 1092 | WP_001289363.1 | ABC transporter ATP-binding protein | - |
| SPR_RS10935 | - | 216000..217001 (-) | 1002 | Protein_231 | extracellular solute-binding protein | - |
Regulatory network
Positive effect
Negative effect
| Regulator | Target | Regulation |
|---|---|---|
| ccnE | comC/comC1 | negative effect  |
| comC/comC1 | comD/comD1 | positive effect  |
| comD/comD1 | comE | positive effect |
| comE | comB | positive effect |
| comB | comC/comC1 | positive effect |
| comE | comD/comD1 | positive effect |
| comA | comC/comC1 | positive effect |
| comE | comA | positive effect |
| ccnD | comC/comC1 | negative effect |
| ccnC | comC/comC1 | negative effect |
| comE | comC/comC1 | positive effect |
| comE | comW | positive effect |
| comE | comX/comX1 | positive effect |
| comE | comX/comX2 | positive effect |
| comE | comM | positive effect |
| comE | comE | positive effect |
| stkP | comE | positive effect |
| htrA | comC/comC1 | negative effect |
| htrA | comEA/celA/cilE | negative effect |
| htrA | comEC/celB | negative effect |
| ciaH | htrA | positive effect |
| ciaR | htrA | positive effect |
| ciaR | comC/comC1 | negative effect |
| ccnA | comC/comC1 | negative effect |
| ciaH | comC/comC1 | negative effect |
| ccnB | comC/comC1 | negative effect |
| comW | comX/comX1 | positive effect |
| comW | comX/comX2 | positive effect |
| clpP | comW | negative effect |
| mecA | comW | negative effect |
| clpC | comW | negative effect |
| comX/comX1 | late competence genes | positive effect |
| clpE | comX/comX1 | negative effect |
| clpP | comX/comX1 | negative effect |
| comX/comX2 | late competence genes | positive effect |
| clpE | comX/comX2 | negative effect |
| clpP | comX/comX2 | negative effect |
| comM | cbpD | negative effect |
| comX/comX2 | late competence genes | positive effect |
| comX/comX1 | late competence genes | positive effect |
| cbpD | lytC | positive effect |
| cbpD | lytA | positive effect |
Sequence
Nucleotide
Download Length: 151 bp
>NTDB_id=679 212277..212427(+) (ccnE) [Streptococcus pneumoniae R6]
ATTAAATAAAGACCTCCTAATATTATTTGAAACAGATAACACTGAATTAGTTTGAATTTGATTTTCATCTAATATCTTTA
TTTAATGAACTCCTAAACTTTTTCATAATAATCTCCTTCAAAAGTCGCCTGTATGGGTGGCTTTTATTTTA
ATTAAATAAAGACCTCCTAATATTATTTGAAACAGATAACACTGAATTAGTTTGAATTTGATTTTCATCTAATATCTTTA
TTTAATGAACTCCTAAACTTTTTCATAATAATCTCCTTCAAAAGTCGCCTGTATGGGTGGCTTTTATTTTA
References
| [1] | Anke Laux et al. (2015) Control of competence by related non-coding csRNAs in Streptococcus pneumoniae R6. Frontiers in Genetics 6:246. [PMID: 26257773] |
| [2] | Anke Schnorpfeil et al. (2013) Target evaluation of the non-coding csRNAs reveals a link of the two-component regulatory system CiaRH to competence control in Streptococcus pneumoniae R6. Molecular Microbiology 89(2):334-49. [PMID: 23710838] |
| [3] | Alexander Halfmann et al. (2007) Identification of the genes directly controlled by the response regulator CiaR in Streptococcus pneumoniae: five out of 15 promoters drive expression of small non-coding RNAs. Molecular Microbiology 66(1):110-26. [PMID: 17725562] |