Detailed information    

experimental Experimentally validated

Overview

Name   ccnB   Type   Regulator
Locus tag   - Genome accession   NC_003098
Coordinates   231330..231426 (+) Length   32.3333333333333 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus pneumoniae R6     
Function   repress competence development   
Competence regulation

Function

Competence in S. pneumoniae is additively controlled by the csRNAs via post-transcriptional regulation of comC


Genomic Context

Location: 226330..236426
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  SPR_RS01230 (spr0235) leuS 227269..229770 (+) 2502 WP_000011789.1 leucine--tRNA ligase -
  SPR_RS01235 (spr0236) - 229964..230659 (+) 696 WP_001144910.1 GNAT family N-acetyltransferase -
  SPR_RS01240 (spr0237) - 230671..231087 (+) 417 WP_000628392.1 GNAT family N-acetyltransferase -
  - ccnB 231330..231426 (+) 97 - - Regulator
  SPR_RS01245 - 231902..231994 (-) 93 WP_000970381.1 type I toxin-antitoxin system Fst family toxin -
  SPR_RS01250 (spr0238) ruvB 232128..233126 (+) 999 WP_001809468.1 Holliday junction branch migration DNA helicase RuvB Machinery gene
  SPR_RS01255 (spr0239) - 233107..233679 (+) 573 WP_001098896.1 nucleotidyltransferase family protein -
  SPR_RS01260 (spr0240) - 233910..234668 (+) 759 WP_000466719.1 isoprenyl transferase -
  SPR_RS01265 (spr0241) - 234677..235480 (+) 804 WP_000189869.1 phosphatidate cytidylyltransferase -

Regulatory network

Positive effect      
Negative effect
Regulator Target Regulation
  ccnB comC/comC1 negative effect
  comC/comC1 comD/comD1 positive effect
  comD/comD1 comE positive effect
  comE comB positive effect
  comB comC/comC1 positive effect
  comE comD/comD1 positive effect
  comA comC/comC1 positive effect
  comE comA positive effect
  ccnD comC/comC1 negative effect
  ccnC comC/comC1 negative effect
  ccnE comC/comC1 negative effect
  comE comC/comC1 positive effect
  comE comW positive effect
  comE comX/comX1 positive effect
  comE comX/comX2 positive effect
  comE comM positive effect
  comE comE positive effect
  stkP comE positive effect
  htrA comC/comC1 negative effect
  htrA comEA/celA/cilE negative effect
  htrA comEC/celB negative effect
  ciaH htrA positive effect
  ciaR htrA positive effect
  ciaR comC/comC1 negative effect
  ccnA comC/comC1 negative effect
  ciaH comC/comC1 negative effect
  comW comX/comX1 positive effect
  comW comX/comX2 positive effect
  clpP comW negative effect
  mecA comW negative effect
  clpC comW negative effect
  comX/comX1 late competence genes positive effect
  clpE comX/comX1 negative effect
  clpP comX/comX1 negative effect
  comX/comX2 late competence genes positive effect
  clpE comX/comX2 negative effect
  clpP comX/comX2 negative effect
  comM cbpD negative effect
  comX/comX2 late competence genes positive effect
  comX/comX1 late competence genes positive effect
  cbpD lytC positive effect
  cbpD lytA positive effect

Sequence

Nucleotide


Download         Length: 97 bp        

>NTDB_id=676 231330..231426(+) (ccnB) [Streptococcus pneumoniae R6]
ATTAAATAAAGACCTCCTAACTTTATTTAATAAAATCCTAAACTTTTCTTTTTCATAATAATCTCCCTTAACTCCACCCA
ATCAGGTGGAGTTTTTT

References

[1] Anke Laux et al. (2015) Control of competence by related non-coding csRNAs in Streptococcus pneumoniae R6. Frontiers in Genetics 6:246. [PMID: 26257773]
[2] Anke Schnorpfeil et al. (2013) Target evaluation of the non-coding csRNAs reveals a link of the two-component regulatory system CiaRH to competence control in Streptococcus pneumoniae R6. Molecular Microbiology 89(2):334-49. [PMID: 23710838]
[3] Alexander Halfmann et al. (2007) Identification of the genes directly controlled by the response regulator CiaR in Streptococcus pneumoniae: five out of 15 promoters drive expression of small non-coding RNAs. Molecular Microbiology 66(1):110-26. [PMID: 17725562]