Detailed information
Overview
| Name | ccnC | Type | Regulator |
| Locus tag | - | Genome accession | NC_003098 |
| Coordinates | 23967..24066 (+) | Length | 33.3333333333333 a.a. |
| NCBI ID | - | Uniprot ID | - |
| Organism | Streptococcus pneumoniae R6 | ||
| Function | repress competence development Competence regulation |
||
Genomic Context
Location: 18967..29066
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SPR_RS00100 | - | 20225..21071 (+) | 847 | Protein_14 | IS630 family transposase | - |
| SPR_RS00105 | - | 21106..21902 (-) | 797 | Protein_15 | transposase | - |
| SPR_RS00110 (spr0020) | comW | 22168..22404 (+) | 237 | WP_000939545.1 | sigma(X)-activator ComW | Regulator |
| SPR_RS00115 (spr0021) | - | 22635..23921 (+) | 1287 | WP_000205044.1 | adenylosuccinate synthase | - |
| - | ccnC | 23967..24066 (+) | 100 | - | - | Regulator |
| SPR_RS00120 (spr0022) | tadA | 24122..24589 (+) | 468 | WP_000291874.1 | tRNA adenosine(34) deaminase TadA | - |
| SPR_RS00130 (spr0023) | - | 24776..25219 (+) | 444 | WP_000701992.1 | dUTP diphosphatase | - |
| SPR_RS00135 (spr0024) | - | 25221..25736 (+) | 516 | WP_000691236.1 | histidine phosphatase family protein | - |
| SPR_RS00140 (spr0025) | radA | 25750..27111 (+) | 1362 | WP_074017595.1 | DNA repair protein RadA | Machinery gene |
| SPR_RS00145 (spr0026) | - | 27184..27681 (+) | 498 | WP_025170955.1 | beta-class carbonic anhydrase | - |
| SPR_RS00150 (spr0027) | - | 27706..28489 (+) | 784 | Protein_23 | PrsW family glutamic-type intramembrane protease | - |
Regulatory network
Positive effect
Negative effect
| Regulator | Target | Regulation |
|---|---|---|
| ccnC | comC/comC1 | negative effect |
| comC/comC1 | comD/comD1 | positive effect |
| comD/comD1 | comE | positive effect |
| comE | comB | positive effect |
| comB | comC/comC1 | positive effect |
| comE | comD/comD1 | positive effect |
| comA | comC/comC1 | positive effect |
| comE | comA | positive effect |
| ccnD | comC/comC1 | negative effect |
| ccnE | comC/comC1 | negative effect |
| comE | comC/comC1 | positive effect |
| comE | comW | positive effect |
| comE | comX/comX1 | positive effect |
| comE | comX/comX2 | positive effect |
| comE | comM | positive effect |
| comE | comE | positive effect |
| stkP | comE | positive effect |
| htrA | comC/comC1 | negative effect |
| htrA | comEA/celA/cilE | negative effect |
| htrA | comEC/celB | negative effect |
| ciaH | htrA | positive effect |
| ciaR | htrA | positive effect |
| ciaR | comC/comC1 | negative effect |
| ccnA | comC/comC1 | negative effect |
| ciaH | comC/comC1 | negative effect |
| ccnB | comC/comC1 | negative effect |
| comW | comX/comX1 | positive effect |
| comW | comX/comX2 | positive effect |
| clpP | comW | negative effect |
| mecA | comW | negative effect |
| clpC | comW | negative effect |
| comX/comX1 | late competence genes | positive effect |
| clpE | comX/comX1 | negative effect |
| clpP | comX/comX1 | negative effect |
| comX/comX2 | late competence genes | positive effect |
| clpE | comX/comX2 | negative effect |
| clpP | comX/comX2 | negative effect |
| comM | cbpD | negative effect |
| comX/comX2 | late competence genes | positive effect |
| comX/comX1 | late competence genes | positive effect |
| cbpD | lytC | positive effect |
| cbpD | lytA | positive effect |
Sequence
Nucleotide
Download Length: 100 bp
>NTDB_id=677 23967..24066(+) (ccnC) [Streptococcus pneumoniae R6]
GGTTACAAGAAGACCTCCTAACTTGTTGTAACAAATATCCTAAACTTTTCTTTTTCATAATAATCTCCCTATAGAGTCAC
CGCATTCGGTGGCTTTTTTT
GGTTACAAGAAGACCTCCTAACTTGTTGTAACAAATATCCTAAACTTTTCTTTTTCATAATAATCTCCCTATAGAGTCAC
CGCATTCGGTGGCTTTTTTT
References
| [1] | Anke Laux et al. (2015) Control of competence by related non-coding csRNAs in Streptococcus pneumoniae R6. Frontiers in Genetics 6:246. [PMID: 26257773] |
| [2] | Anke Schnorpfeil et al. (2013) Target evaluation of the non-coding csRNAs reveals a link of the two-component regulatory system CiaRH to competence control in Streptococcus pneumoniae R6. Molecular Microbiology 89(2):334-49. [PMID: 23710838] |
| [3] | Alexander Halfmann et al. (2007) Identification of the genes directly controlled by the response regulator CiaR in Streptococcus pneumoniae: five out of 15 promoters drive expression of small non-coding RNAs. Molecular Microbiology 66(1):110-26. [PMID: 17725562] |