Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | XCM_RS06530 | Genome accession | NZ_CP073209 |
| Coordinates | 1466614..1466733 (+) | Length | 39 a.a. |
| NCBI ID | WP_033482837.1 | Uniprot ID | - |
| Organism | Xanthomonas citri pv. mangiferaeindicae strain GXG07 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1461614..1471733
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| XCM_RS06505 (XCM_6410) | pilC | 1462197..1463456 (-) | 1260 | WP_033483308.1 | type II secretion system F family protein | Machinery gene |
| XCM_RS06510 (XCM_6415) | comP | 1463801..1464229 (+) | 429 | WP_005921364.1 | pilin | Machinery gene |
| XCM_RS22920 (XCM_6420) | pilA2 | 1464326..1464739 (+) | 414 | WP_005921365.1 | pilin | Machinery gene |
| XCM_RS06525 (XCM_6425) | pilB | 1464781..1466517 (+) | 1737 | WP_033482835.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| XCM_RS06530 (XCM_6430) | pilB | 1466614..1466733 (+) | 120 | WP_033482837.1 | hypothetical protein | Machinery gene |
| XCM_RS06535 (XCM_6435) | - | 1466865..1467020 (+) | 156 | WP_003488595.1 | hypothetical protein | - |
| XCM_RS06540 (XCM_6440) | pilR | 1467218..1468612 (-) | 1395 | WP_003488597.1 | sigma-54 dependent transcriptional regulator | Regulator |
| XCM_RS06545 (XCM_6445) | - | 1468941..1470554 (-) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4205.86 Da Isoelectric Point: 9.0113
>NTDB_id=558299 XCM_RS06530 WP_033482837.1 1466614..1466733(+) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain GXG07]
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=558299 XCM_RS06530 WP_033482837.1 1466614..1466733(+) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain GXG07]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
48.718 |
100 |
0.487 |
| pilB | Acinetobacter baumannii D1279779 |
46.154 |
100 |
0.462 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilB | Vibrio cholerae strain A1552 |
42.857 |
89.744 |
0.385 |