NTDB

Overview

Name	comYE	Type	Machinery gene
Locus tag	I6H76_RS05100	Genome accession	NZ_CP065994
Coordinates	1010959..1011252 (-)	Length	97 a.a.
NCBI ID	WP_006531746.1	Uniprot ID	-
Organism	Streptococcus infantarius strain FDAARGOS_1019
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1005959..1016252

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
I6H76_RS05060 (I6H76_05060)	-	1006275..1006910 (-)	636	WP_014334210.1	CPBP family intramembrane glutamic endopeptidase	-
I6H76_RS05065 (I6H76_05065)	-	1006925..1007380 (-)	456	WP_006531739.1	hypothetical protein	-
I6H76_RS05070 (I6H76_05070)	-	1007381..1007581 (-)	201	WP_006531740.1	hypothetical protein	-
I6H76_RS05075 (I6H76_05075)	-	1007597..1007794 (-)	198	WP_006531741.1	helix-turn-helix transcriptional regulator	-
I6H76_RS05080 (I6H76_05080)	-	1007953..1009152 (-)	1200	WP_006531742.1	acetate kinase	-
I6H76_RS05085 (I6H76_05085)	comYH	1009206..1010162 (-)	957	WP_006531743.1	class I SAM-dependent methyltransferase	Machinery gene
I6H76_RS05090 (I6H76_05090)	comGG	1010216..1010566 (-)	351	WP_043878322.1	competence type IV pilus minor pilin ComGG	-
I6H76_RS05095 (I6H76_05095)	comYF	1010538..1010975 (-)	438	WP_006531745.1	competence type IV pilus minor pilin ComGF	Machinery gene
I6H76_RS05100 (I6H76_05100)	comYE	1010959..1011252 (-)	294	WP_006531746.1	competence type IV pilus minor pilin ComGE	Machinery gene
I6H76_RS05105 (I6H76_05105)	comYD	1011206..1011637 (-)	432	WP_006531747.1	competence type IV pilus minor pilin ComGD	Machinery gene
I6H76_RS05110 (I6H76_05110)	comGC/cglC	1011621..1011914 (-)	294	WP_006531748.1	competence type IV pilus major pilin ComGC	Machinery gene
I6H76_RS05115 (I6H76_05115)	comYB	1011914..1012957 (-)	1044	WP_174221225.1	competence type IV pilus assembly protein ComGB	Machinery gene
I6H76_RS05120 (I6H76_05120)	comYA	1012881..1013822 (-)	942	WP_043878331.1	competence type IV pilus ATPase ComGA	Machinery gene
I6H76_RS05125 (I6H76_05125)	-	1013935..1014264 (-)	330	WP_006531751.1	DUF1033 family protein	-

Sequence

Protein

Download Length: 97 a.a. Molecular weight: 10822.62 Da Isoelectric Point: 6.8789

                                >NTDB_id=516131 I6H76_RS05100 WP_006531746.1 1010959..1011252(-) (comYE) [Streptococcus infantarius strain FDAARGOS_1019]

MVTIKKQKLKAYILLEGLVALALLATITSLILGEMDRSRTQMQESLHQQEVLNVATMAAQIGQDHLAINGVEVRMVKHDN

EISIYDGQNEVLHAKKN

Nucleotide

Download Length: 294 bp

                                >NTDB_id=516131 I6H76_RS05100 WP_006531746.1 1010959..1011252(-) (comYE) [Streptococcus infantarius strain FDAARGOS_1019]

GTGGTAACTATAAAAAAACAGAAACTAAAAGCGTATATACTCCTTGAGGGGTTGGTAGCACTAGCTTTATTAGCAACGAT

AACCAGTCTGATCTTAGGAGAAATGGACCGTAGTCGCACTCAAATGCAAGAGAGTTTGCATCAGCAAGAGGTACTTAATG

TAGCGACCATGGCCGCTCAAATAGGACAAGACCATTTGGCTATTAATGGGGTTGAGGTGCGTATGGTTAAGCATGATAAT

GAGATTTCCATTTATGATGGTCAAAATGAGGTTTTACATGCCAAAAAAAACTAG

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-93)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comYE	Streptococcus mutans UA140	51.042	98.969	0.505
comYE	Streptococcus mutans UA159	51.042	98.969	0.505
comGE/cglE	Streptococcus pneumoniae Rx1	40.426	96.907	0.392
comGE/cglE	Streptococcus pneumoniae D39	40.426	96.907	0.392
comGE/cglE	Streptococcus pneumoniae R6	40.426	96.907	0.392
comGE/cglE	Streptococcus pneumoniae TIGR4	40.426	96.907	0.392
comGE/cglE	Streptococcus mitis SK321	39.362	96.907	0.381
comGE/cglE	Streptococcus mitis NCTC 12261	39.362	96.907	0.381

Detailed information NTG0516131