Detailed information
Bioinformatically predicted
Overview
| Name | comC/blpC | Type | Regulator |
| Locus tag | IBL27_RS01305 | Genome accession | NZ_CP061071 |
| Coordinates | 263978..264109 (-) | Length | 43 a.a. |
| NCBI ID | WP_002268639.1 | Uniprot ID | Q9APK6 |
| Organism | Streptococcus mutans B04Sm5 | ||
| Function | binding to ComD; induce autophosphorylation of ComD; regulation of comX expression (predicted from homology) Competence regulation |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| ICE | 238443..316348 | 263978..264109 | within | 0 |
Gene organization within MGE regions
Location: 238443..316348
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| IBL27_RS01185 (IBL27_01185) | - | 239407..240780 (+) | 1374 | WP_002262136.1 | M20/M25/M40 family metallo-hydrolase | - |
| IBL27_RS01190 (IBL27_01190) | - | 240773..241837 (+) | 1065 | WP_002286775.1 | methionine ABC transporter ATP-binding protein | - |
| IBL27_RS01195 (IBL27_01195) | - | 241839..242528 (+) | 690 | WP_002262134.1 | methionine ABC transporter permease | - |
| IBL27_RS01200 (IBL27_01200) | - | 242596..243372 (+) | 777 | WP_002278262.1 | carbon-nitrogen family hydrolase | - |
| IBL27_RS01205 (IBL27_01205) | - | 243496..244341 (+) | 846 | WP_002265444.1 | SAM hydrolase/SAM-dependent halogenase family protein | - |
| IBL27_RS01210 (IBL27_01210) | - | 244351..244896 (+) | 546 | WP_002308990.1 | ECF-type riboflavin transporter substrate-binding protein | - |
| IBL27_RS01215 (IBL27_01215) | - | 244925..246601 (+) | 1677 | WP_002274871.1 | ABC transporter ATP-binding protein | - |
| IBL27_RS01220 (IBL27_01220) | - | 246594..247427 (+) | 834 | WP_002270261.1 | energy-coupling factor transporter transmembrane component T family protein | - |
| IBL27_RS01225 (IBL27_01225) | rsmG | 247651..248364 (-) | 714 | WP_002276611.1 | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG | - |
| IBL27_RS01230 (IBL27_01230) | - | 248452..249012 (+) | 561 | WP_002274869.1 | LemA family protein | - |
| IBL27_RS01235 (IBL27_01235) | htpX | 249022..249921 (+) | 900 | WP_002288189.1 | zinc metalloprotease HtpX | - |
| IBL27_RS01240 (IBL27_01240) | - | 250058..252670 (-) | 2613 | WP_002311318.1 | ABC transporter permease | - |
| IBL27_RS01245 (IBL27_01245) | - | 252672..253379 (-) | 708 | WP_002308988.1 | ABC transporter ATP-binding protein | - |
| IBL27_RS01250 (IBL27_01250) | - | 253487..254062 (+) | 576 | WP_002265122.1 | TetR/AcrR family transcriptional regulator | - |
| IBL27_RS01255 (IBL27_01255) | - | 254055..254591 (+) | 537 | WP_002262122.1 | DUF177 domain-containing protein | - |
| IBL27_RS01260 (IBL27_01260) | covR | 254947..255639 (+) | 693 | WP_002262121.1 | response regulator GcrR | Regulator |
| IBL27_RS01265 (IBL27_01265) | nrdR | 256007..256498 (+) | 492 | WP_002262120.1 | transcriptional regulator NrdR | - |
| IBL27_RS01270 (IBL27_01270) | - | 256485..257654 (+) | 1170 | WP_002262119.1 | DnaD domain protein | - |
| IBL27_RS01275 (IBL27_01275) | dnaI | 257655..258554 (+) | 900 | WP_002308985.1 | primosomal protein DnaI | - |
| IBL27_RS01280 (IBL27_01280) | der | 258567..259877 (+) | 1311 | WP_002272420.1 | ribosome biogenesis GTPase Der | - |
| IBL27_RS01285 (IBL27_01285) | - | 259952..260578 (+) | 627 | WP_002278266.1 | hypothetical protein | - |
| IBL27_RS01290 (IBL27_01290) | - | 260626..261264 (+) | 639 | WP_002265117.1 | VTT domain-containing protein | - |
| IBL27_RS01295 (IBL27_01295) | comE/blpR | 261735..262487 (+) | 753 | WP_002270252.1 | response regulator transcription factor | Regulator |
| IBL27_RS01300 (IBL27_01300) | comD/blpH | 262484..263809 (+) | 1326 | WP_002308983.1 | sensor histidine kinase | Regulator |
| IBL27_RS01305 (IBL27_01305) | comC/blpC | 263978..264109 (-) | 132 | WP_002268639.1 | ComC/BlpC family leader-containing pheromone/bacteriocin | Regulator |
| IBL27_RS01310 (IBL27_01310) | cipB | 264376..264606 (+) | 231 | WP_002309764.1 | Blp family class II bacteriocin | Regulator |
| IBL27_RS01315 (IBL27_01315) | - | 264737..265138 (+) | 402 | WP_002310604.1 | hypothetical protein | - |
| IBL27_RS01320 (IBL27_01320) | - | 266518..266937 (+) | 420 | WP_002263913.1 | hypothetical protein | - |
| IBL27_RS01325 (IBL27_01325) | - | 267084..267488 (+) | 405 | WP_002263912.1 | hypothetical protein | - |
| IBL27_RS09845 | - | 267611..267823 (-) | 213 | Protein_238 | IS3 family transposase | - |
| IBL27_RS01330 (IBL27_01330) | - | 268263..268427 (+) | 165 | WP_002265308.1 | hypothetical protein | - |
| IBL27_RS01335 (IBL27_01335) | - | 268832..269044 (+) | 213 | WP_002309424.1 | Blp family class II bacteriocin | - |
| IBL27_RS01340 (IBL27_01340) | - | 269208..269396 (+) | 189 | WP_002309422.1 | Blp family class II bacteriocin | - |
| IBL27_RS01345 (IBL27_01345) | - | 269882..270904 (+) | 1023 | WP_002311309.1 | thioredoxin family protein | - |
| IBL27_RS01350 (IBL27_01350) | - | 271195..271338 (+) | 144 | WP_002263740.1 | hypothetical protein | - |
| IBL27_RS01355 (IBL27_01355) | comB | 271600..272613 (-) | 1014 | WP_002309418.1 | HlyD family efflux transporter periplasmic adaptor subunit | Regulator |
| IBL27_RS01360 (IBL27_01360) | - | 272626..274450 (-) | 1825 | Protein_245 | peptide cleavage/export ABC transporter | - |
| IBL27_RS01365 (IBL27_01365) | - | 274472..275689 (-) | 1218 | Protein_246 | IS3 family transposase | - |
| IBL27_RS01370 (IBL27_01370) | - | 275702..276148 (-) | 447 | Protein_247 | cysteine peptidase family C39 domain-containing protein | - |
| IBL27_RS01375 (IBL27_01375) | - | 276536..276790 (+) | 255 | WP_002267515.1 | Blp family class II bacteriocin | - |
| IBL27_RS01380 (IBL27_01380) | - | 276835..276996 (+) | 162 | WP_002263734.1 | Blp family class II bacteriocin | - |
| IBL27_RS01385 (IBL27_01385) | - | 277134..277319 (+) | 186 | WP_002263346.1 | ComC/BlpC family leader-containing pheromone/bacteriocin | - |
| IBL27_RS01390 (IBL27_01390) | - | 277620..277814 (+) | 195 | WP_154079691.1 | ComC/BlpC family leader-containing pheromone/bacteriocin | - |
| IBL27_RS01395 (IBL27_01395) | - | 277854..278018 (+) | 165 | WP_002273566.1 | class IIb bacteriocin, lactobin A/cerein 7B family | - |
| IBL27_RS01400 (IBL27_01400) | - | 278433..278696 (+) | 264 | WP_002352361.1 | Blp family class II bacteriocin | - |
| IBL27_RS01405 (IBL27_01405) | serS | 279379..280659 (-) | 1281 | WP_002278058.1 | serine--tRNA ligase | - |
| IBL27_RS09850 | - | 280710..281066 (+) | 357 | WP_002308764.1 | hypothetical protein | - |
| IBL27_RS01415 (IBL27_01415) | - | 281182..282255 (+) | 1074 | WP_024784339.1 | acyltransferase | - |
| IBL27_RS01420 (IBL27_01420) | - | 282491..282859 (-) | 369 | WP_002263350.1 | DUF956 family protein | - |
| IBL27_RS01425 (IBL27_01425) | - | 283199..284125 (-) | 927 | WP_002278056.1 | PTS system mannose/fructose/sorbose family transporter subunit IID | - |
| IBL27_RS01430 (IBL27_01430) | - | 284140..284958 (-) | 819 | WP_002263354.1 | PTS mannose/fructose/sorbose transporter subunit IIC | - |
| IBL27_RS01435 (IBL27_01435) | - | 284993..285985 (-) | 993 | WP_002308759.1 | PTS sugar transporter subunit IIB | - |
| IBL27_RS01440 (IBL27_01440) | - | 286862..287332 (-) | 471 | WP_002263356.1 | hypothetical protein | - |
| IBL27_RS01445 (IBL27_01445) | - | 287431..289794 (-) | 2364 | WP_002308757.1 | ATP-dependent RecD-like DNA helicase | - |
| IBL27_RS01450 (IBL27_01450) | lepB | 289880..290467 (-) | 588 | WP_002263358.1 | signal peptidase I | - |
| IBL27_RS01455 (IBL27_01455) | rnhC | 290487..291398 (-) | 912 | WP_002271343.1 | ribonuclease HIII | - |
| IBL27_RS01460 (IBL27_01460) | - | 291594..291899 (+) | 306 | WP_002263360.1 | hypothetical protein | - |
| IBL27_RS01465 (IBL27_01465) | - | 291896..292441 (+) | 546 | WP_002263361.1 | CvpA family protein | - |
| IBL27_RS01470 (IBL27_01470) | - | 292844..293590 (+) | 747 | WP_002264188.1 | CPBP family intramembrane glutamic endopeptidase | - |
| IBL27_RS01475 (IBL27_01475) | - | 293809..296139 (+) | 2331 | WP_002308754.1 | endonuclease MutS2 | - |
| IBL27_RS01480 (IBL27_01480) | trxA | 296214..296528 (+) | 315 | WP_002263363.1 | thioredoxin | - |
| IBL27_RS01485 (IBL27_01485) | - | 296626..297675 (+) | 1050 | WP_002268247.1 | zinc-dependent alcohol dehydrogenase family protein | - |
| IBL27_RS01490 (IBL27_01490) | mutY | 297863..299008 (-) | 1146 | WP_002265472.1 | A/G-specific adenine glycosylase | - |
| IBL27_RS01495 (IBL27_01495) | - | 300085..300255 (-) | 171 | WP_002308751.1 | hypothetical protein | - |
| IBL27_RS01500 (IBL27_01500) | - | 300560..300805 (+) | 246 | WP_002263367.1 | hypothetical protein | - |
| IBL27_RS01505 (IBL27_01505) | rpsF | 300961..301251 (+) | 291 | WP_002261866.1 | 30S ribosomal protein S6 | - |
| IBL27_RS01510 (IBL27_01510) | ssbA | 301269..301763 (+) | 495 | WP_002261867.1 | single-stranded DNA-binding protein | Machinery gene |
| IBL27_RS01515 (IBL27_01515) | rpsR | 301793..302032 (+) | 240 | WP_000068664.1 | 30S ribosomal protein S18 | - |
| IBL27_RS01520 (IBL27_01520) | - | 302351..303070 (+) | 720 | WP_002309022.1 | TraX family protein | - |
| IBL27_RS01525 (IBL27_01525) | hdrM | 303078..303764 (-) | 687 | WP_002268420.1 | hdrR negative regulator HdrM | Regulator |
| IBL27_RS01530 (IBL27_01530) | hdrR | 303761..304117 (-) | 357 | WP_002268419.1 | LytTR family transcriptional regulator HdrR | Regulator |
| IBL27_RS01535 (IBL27_01535) | - | 304256..304918 (-) | 663 | WP_002282225.1 | DUF1129 domain-containing protein | - |
| IBL27_RS01540 (IBL27_01540) | - | 305200..306144 (-) | 945 | WP_024784412.1 | magnesium transporter CorA family protein | - |
| IBL27_RS01545 (IBL27_01545) | - | 306544..306765 (-) | 222 | WP_019312622.1 | hypothetical protein | - |
| IBL27_RS01550 (IBL27_01550) | uvrA | 306815..309646 (+) | 2832 | WP_002311283.1 | excinuclease ABC subunit UvrA | - |
| IBL27_RS01555 (IBL27_01555) | - | 309636..310700 (+) | 1065 | WP_002269076.1 | M24 family metallopeptidase | - |
| IBL27_RS01560 (IBL27_01560) | - | 310862..311314 (+) | 453 | WP_002262664.1 | deoxycytidylate deaminase | - |
| IBL27_RS01565 (IBL27_01565) | - | 311362..312066 (-) | 705 | WP_002264996.1 | ion transporter | - |
| IBL27_RS01570 (IBL27_01570) | efp | 312206..312766 (+) | 561 | WP_002262662.1 | elongation factor P | - |
| IBL27_RS01575 (IBL27_01575) | - | 312809..313198 (+) | 390 | WP_002262661.1 | Asp23/Gls24 family envelope stress response protein | - |
| IBL27_RS01580 (IBL27_01580) | nusB | 313191..313619 (+) | 429 | WP_002264997.1 | transcription antitermination factor NusB | - |
| IBL27_RS01585 (IBL27_01585) | - | 313813..314775 (-) | 963 | WP_002265695.1 | LacI family DNA-binding transcriptional regulator | - |
| IBL27_RS01590 (IBL27_01590) | - | 314778..316217 (-) | 1440 | WP_002309029.1 | sucrose-6-phosphate hydrolase | - |
Sequence
Protein
Download Length: 43 a.a. Molecular weight: 4926.71 Da Isoelectric Point: 10.1937
>NTDB_id=480228 IBL27_RS01305 WP_002268639.1 263978..264109(-) (comC/blpC) [Streptococcus mutans B04Sm5]
MKKTLSLKNDFKEIKTDELEIIIGGSGTLSTFFRLFNRSFTQA
MKKTLSLKNDFKEIKTDELEIIIGGSGTLSTFFRLFNRSFTQA
Nucleotide
Download Length: 132 bp
>NTDB_id=480228 IBL27_RS01305 WP_002268639.1 263978..264109(-) (comC/blpC) [Streptococcus mutans B04Sm5]
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAAACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AACCCTGTCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTAG
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAAACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AACCCTGTCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTAG
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comC/blpC | Streptococcus mutans UA159 |
97.674 |
100 |
0.977 |
| comC/comC1 | Streptococcus pneumoniae R6 |
44.444 |
83.721 |
0.372 |
| comC/comC1 | Streptococcus pneumoniae G54 |
44.444 |
83.721 |
0.372 |
| comC/comC1 | Streptococcus pneumoniae D39 |
44.444 |
83.721 |
0.372 |
| comC/comC1 | Streptococcus pneumoniae Rx1 |
44.444 |
83.721 |
0.372 |