Detailed information NTG0409430

Bioinformatically predicted

Overview

• Name: comYE
• Type: Machinery gene
• Locus tag: GPZ88_RS05075
• Genome accession: NZ_CP046919
• Coordinates: 973370..973663 (+)
• Length: 97 a.a.
• NCBI ID: WP_166043607.1
• Uniprot ID: A0A6G8HZV3
• Organism: Streptococcus ruminicola strain CNU_G2
• Function: dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 968370..978663

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
GPZ88_RS05050 (GPZ88_05015)	-	970362..970730 (+)	369	WP_166043601.1	DUF1033 family protein	-
GPZ88_RS05055 (GPZ88_05020)	comYA	970800..971741 (+)	942	WP_166043603.1	competence type IV pilus ATPase ComGA	Machinery gene
GPZ88_RS05060 (GPZ88_05025)	comYB	971665..972708 (+)	1044	WP_206282135.1	competence type IV pilus assembly protein ComGB	Machinery gene
GPZ88_RS05065 (GPZ88_05030)	comGC/cglC	972708..973001 (+)	294	WP_074561132.1	competence type IV pilus major pilin ComGC	Machinery gene
GPZ88_RS05070 (GPZ88_05035)	comYD	972985..973416 (+)	432	WP_157628644.1	competence type IV pilus minor pilin ComGD	Machinery gene
GPZ88_RS05075 (GPZ88_05040)	comYE	973370..973663 (+)	294	WP_166043607.1	competence type IV pilus minor pilin ComGE	Machinery gene
GPZ88_RS05080 (GPZ88_05045)	comYF	973647..974084 (+)	438	WP_133018089.1	competence type IV pilus minor pilin ComGF	Machinery gene
GPZ88_RS05085 (GPZ88_05050)	comGG	974056..974406 (+)	351	WP_133018088.1	competence type IV pilus minor pilin ComGG	-
GPZ88_RS05090 (GPZ88_05055)	comYH	974460..975416 (+)	957	WP_006531743.1	class I SAM-dependent methyltransferase	Machinery gene
GPZ88_RS05095 (GPZ88_05060)	-	975470..976669 (+)	1200	WP_166043609.1	acetate kinase	-
GPZ88_RS05100 (GPZ88_05065)	-	976829..977026 (+)	198	WP_074561137.1	helix-turn-helix transcriptional regulator	-
GPZ88_RS05105 (GPZ88_05070)	-	977042..977242 (+)	201	WP_074965270.1	hypothetical protein	-
GPZ88_RS05110 (GPZ88_05075)	-	977243..977698 (+)	456	WP_240915112.1	ABC transporter permease	-
GPZ88_RS05115 (GPZ88_05080)	-	977714..978349 (+)	636	WP_039697423.1	CPBP family intramembrane glutamic endopeptidase	-

Sequence

Protein

• Length: 97 a.a.
• Molecular weight: 10778.48 Da
• Isoelectric Point: 6.3223

>NTDB_id=409430 GPZ88_RS05075 WP_166043607.1 973370..973663(+) (comYE) [Streptococcus ruminicola strain CNU_G2]
MVTIKKQKLKAYILLEGLVALALLATITSLVLGEMDHSRTQMQESLHQQEVLNVATMAAQTGQDHLAINGVEVRMVKHDN
EISIYDGQNEVLHVTKN

Nucleotide

• Length: 294 bp

>NTDB_id=409430 GPZ88_RS05075 WP_166043607.1 973370..973663(+) (comYE) [Streptococcus ruminicola strain CNU_G2]
GTGGTAACTATAAAAAAACAGAAACTAAAAGCTTACATACTCCTTGAGGGGTTAGTAGCACTAGCCTTATTAGCAACGAT
AACCAGTCTGGTCTTAGGAGAAATGGACCATAGTCGCACTCAAATGCAAGAGAGTTTGCATCAGCAAGAGGTACTTAATG
TAGCGACCATGGCCGCTCAAACAGGACAAGACCATTTGGCTATTAATGGGGTTGAGGTGCGTATGGTTAAGCATGATAAT
GAGATTTCCATTTATGATGGGCAAAACGAGGTGCTACATGTCACGAAAAATTAG

Domains

Predicted by InterproScan.

• Type II secretory pathway pseudopilin (ComGE) (13-94)

3D structure

• AlphaFold DB: A0A6G8HZV3

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
comYE	Streptococcus mutans UA140	52.083	98.969	0.515
comYE	Streptococcus mutans UA159	52.083	98.969	0.515
comGE/cglE	Streptococcus pneumoniae Rx1	41.304	94.845	0.392
comGE/cglE	Streptococcus pneumoniae D39	41.304	94.845	0.392
comGE/cglE	Streptococcus pneumoniae R6	41.304	94.845	0.392
comGE/cglE	Streptococcus pneumoniae TIGR4	41.304	94.845	0.392
comGE/cglE	Streptococcus mitis SK321	40.217	94.845	0.381
comGE/cglE	Streptococcus mitis NCTC 12261	40.217	94.845	0.381