Detailed information
Bioinformatically predicted
Overview
| Name | comFC/cflB | Type | Machinery gene |
| Locus tag | AYR62_RS17425 | Genome accession | NZ_CP014915 |
| Coordinates | 779244..779348 (+) | Length | 34 a.a. |
| NCBI ID | WP_235810879.1 | Uniprot ID | - |
| Organism | Secundilactobacillus paracollinoides strain TMW 1.1994 | ||
| Function | ssDNA transport into the cell (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 774244..784348
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| AYR62_RS03260 (AYR62_03260) | - | 775474..776421 (-) | 948 | WP_404814726.1 | acyltransferase family protein | - |
| AYR62_RS03270 (AYR62_03270) | - | 776660..777307 (-) | 648 | WP_065902770.1 | YigZ family protein | - |
| AYR62_RS03275 (AYR62_03275) | - | 777360..778661 (+) | 1302 | WP_065902772.1 | DEAD/DEAH box helicase | - |
| AYR62_RS03280 (AYR62_03280) | - | 778662..779132 (+) | 471 | WP_225363097.1 | hypothetical protein | - |
| AYR62_RS17425 | comFC/cflB | 779244..779348 (+) | 105 | WP_235810879.1 | hypothetical protein | Machinery gene |
| AYR62_RS03285 (AYR62_03285) | hpf | 779475..780035 (+) | 561 | WP_065902774.1 | ribosome hibernation-promoting factor, HPF/YfiA family | - |
| AYR62_RS03290 (AYR62_03290) | secA | 780304..782670 (+) | 2367 | WP_065911746.1 | preprotein translocase subunit SecA | - |
| AYR62_RS03295 (AYR62_03295) | prfB | 782749..783922 (+) | 1174 | WP_404814727.1 | peptide chain release factor 2 | - |
Sequence
Protein
Download Length: 34 a.a. Molecular weight: 3524.95 Da Isoelectric Point: 5.3351
>NTDB_id=175139 AYR62_RS17425 WP_235810879.1 779244..779348(+) (comFC/cflB) [Secundilactobacillus paracollinoides strain TMW 1.1994]
MDDIYTTGTTIRFAAHLLAEAGAAEVHGLTLAHG
MDDIYTTGTTIRFAAHLLAEAGAAEVHGLTLAHG
Nucleotide
Download Length: 105 bp
>NTDB_id=175139 AYR62_RS17425 WP_235810879.1 779244..779348(+) (comFC/cflB) [Secundilactobacillus paracollinoides strain TMW 1.1994]
GTGGATGACATCTACACAACTGGCACTACGATAAGGTTTGCAGCACATTTGTTAGCCGAAGCAGGGGCGGCTGAAGTGCA
TGGGTTGACACTTGCTCACGGATAA
GTGGATGACATCTACACAACTGGCACTACGATAAGGTTTGCAGCACATTTGTTAGCCGAAGCAGGGGCGGCTGAAGTGCA
TGGGTTGACACTTGCTCACGGATAA
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comFC/cflB | Streptococcus mitis NCTC 12261 |
58.065 |
91.176 |
0.529 |
| comFC | Bacillus subtilis subsp. subtilis str. 168 |
56.25 |
94.118 |
0.529 |
| comFC/cflB | Streptococcus pneumoniae Rx1 |
54.839 |
91.176 |
0.5 |
| comFC/cflB | Streptococcus pneumoniae D39 |
54.839 |
91.176 |
0.5 |
| comFC/cflB | Streptococcus pneumoniae R6 |
54.839 |
91.176 |
0.5 |
| comFC/cflB | Streptococcus pneumoniae TIGR4 |
54.839 |
91.176 |
0.5 |
| comFC/cflB | Streptococcus mitis SK321 |
54.839 |
91.176 |
0.5 |
| comF | Porphyromonas gingivalis W83 |
50 |
94.118 |
0.471 |
| comFC | Latilactobacillus sakei subsp. sakei 23K |
45.455 |
97.059 |
0.441 |
| comFC | Lactococcus lactis subsp. cremoris KW2 |
45.161 |
91.176 |
0.412 |
| comF | Riemerella anatipestifer ATCC 11845 = DSM 15868 |
40.625 |
94.118 |
0.382 |