Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ACJGJ0_RS08210 | Genome accession | NZ_CP174366 |
| Coordinates | 1919284..1919403 (-) | Length | 39 a.a. |
| NCBI ID | WP_033482837.1 | Uniprot ID | - |
| Organism | Xanthomonas citri pv. mangiferaeindicae strain GXBS06 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1914284..1924403
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ACJGJ0_RS08195 (ACJGJ0_08195) | - | 1915463..1917076 (+) | 1614 | WP_003488599.1 | PAS domain-containing sensor histidine kinase | - |
| ACJGJ0_RS08200 (ACJGJ0_08200) | pilR | 1917405..1918799 (+) | 1395 | WP_003488597.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ACJGJ0_RS08205 (ACJGJ0_08205) | - | 1918997..1919152 (-) | 156 | WP_003488595.1 | hypothetical protein | - |
| ACJGJ0_RS08210 (ACJGJ0_08210) | pilB | 1919284..1919403 (-) | 120 | WP_033482837.1 | hypothetical protein | Machinery gene |
| ACJGJ0_RS08215 (ACJGJ0_08215) | pilB | 1919500..1921236 (-) | 1737 | WP_033482835.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ACJGJ0_RS08220 (ACJGJ0_08220) | pilA2 | 1921278..1921691 (-) | 414 | WP_005921365.1 | pilin | Machinery gene |
| ACJGJ0_RS08225 (ACJGJ0_08225) | comP | 1921788..1922216 (-) | 429 | WP_005921364.1 | pilin | Machinery gene |
| ACJGJ0_RS08230 (ACJGJ0_08230) | pilC | 1922561..1923820 (+) | 1260 | WP_033483308.1 | type II secretion system F family protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4205.86 Da Isoelectric Point: 9.0113
>NTDB_id=1076884 ACJGJ0_RS08210 WP_033482837.1 1919284..1919403(-) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain GXBS06]
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1076884 ACJGJ0_RS08210 WP_033482837.1 1919284..1919403(-) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain GXBS06]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
48.718 |
100 |
0.487 |
| pilB | Acinetobacter baumannii D1279779 |
46.154 |
100 |
0.462 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilB | Vibrio cholerae strain A1552 |
42.857 |
89.744 |
0.385 |