Detailed information NTG0105841

Bioinformatically predicted

Overview

• Name: comGE/cglE
• Type: Machinery gene
• Locus tag: AAA982_RS09590
• Genome accession: NZ_AP028601
• Coordinates: 1849028..1849330 (-)
• Length: 100 a.a.
• NCBI ID: WP_000413382.1
• Uniprot ID: -
• Organism: Streptococcus pneumoniae strain PF1
• Function: dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1844028..1854330

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
AAA982_RS09555 (TKY113292_18600)	rnpA	1844708..1845079 (-)	372	WP_000739246.1	ribonuclease P protein component	-
AAA982_RS09560	-	1845096..1845227 (-)	132	WP_000768904.1	hypothetical protein	-
AAA982_RS09565 (TKY113292_18610)	-	1845228..1846418 (-)	1191	WP_050085692.1	acetate kinase	-
AAA982_RS09570 (TKY113292_18620)	comYH	1846469..1847422 (-)	954	WP_044813830.1	class I SAM-dependent methyltransferase	Machinery gene
AAA982_RS09575	-	1847483..1848077 (-)	595	Protein_1860	methyltransferase domain-containing protein	-
AAA982_RS09580 (TKY113292_18650)	comGG/cglG	1848180..1848626 (-)	447	WP_001811371.1	competence type IV pilus minor pilin ComGG	Machinery gene
AAA982_RS09585	comGF/cglF	1848604..1849065 (-)	462	WP_000250539.1	competence type IV pilus minor pilin ComGF	Machinery gene
AAA982_RS09590 (TKY113292_18670)	comGE/cglE	1849028..1849330 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
AAA982_RS09595 (TKY113292_18680)	comGD/cglD	1849293..1849697 (-)	405	WP_000588030.1	competence type IV pilus minor pilin ComGD	Machinery gene
AAA982_RS09600 (TKY113292_18690)	comGC/cglC	1849690..1850016 (-)	327	WP_000738625.1	competence type IV pilus major pilin ComGC	Machinery gene
AAA982_RS09605 (TKY113292_18700)	comGB/cglB	1850018..1851034 (-)	1017	WP_138028521.1	competence type IV pilus assembly protein ComGB	Machinery gene
AAA982_RS09610 (TKY113292_18710)	comGA/cglA/cilD	1850982..1851923 (-)	942	WP_016398028.1	competence type IV pilus ATPase ComGA	Machinery gene
AAA982_RS09615 (TKY113292_18720)	-	1851999..1852364 (-)	366	WP_000286415.1	DUF1033 family protein	-
AAA982_RS09620 (TKY113292_18730)	-	1852515..1853573 (-)	1059	WP_000649473.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

• Length: 100 a.a.
• Molecular weight: 11108.08 Da
• Isoelectric Point: 9.7273

>NTDB_id=105841 AAA982_RS09590 WP_000413382.1 1849028..1849330(-) (comGE/cglE) [Streptococcus pneumoniae strain PF1]
MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS
SEKGLEVYHGSEQLLAIKEP

Nucleotide

• Length: 303 bp

>NTDB_id=105841 AAA982_RS09590 WP_000413382.1 1849028..1849330(-) (comGE/cglE) [Streptococcus pneumoniae strain PF1]
ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT
TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG
TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT
AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

• Type II secretory pathway pseudopilin (ComGE) (16-97)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4