Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ACDH70_RS18195 | Genome accession | NZ_CP167865 |
| Coordinates | 4271854..4271973 (+) | Length | 39 a.a. |
| NCBI ID | WP_029220459.1 | Uniprot ID | A0A7Z2ZHL3 |
| Organism | Xanthomonas axonopodis pv. poinsettiicola strain NCPPB:1939 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 4266854..4276973
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ACDH70_RS18175 (ACDH70_18175) | - | 4266878..4267330 (+) | 453 | WP_228963894.1 | GtrA family protein | - |
| ACDH70_RS18180 (ACDH70_18180) | - | 4267323..4268867 (+) | 1545 | WP_228963893.1 | NAD(P)/FAD-dependent oxidoreductase | - |
| ACDH70_RS18185 (ACDH70_18185) | galE | 4268958..4269935 (+) | 978 | WP_372360353.1 | UDP-glucose 4-epimerase GalE | - |
| ACDH70_RS18190 (ACDH70_18190) | pilB | 4270052..4271788 (+) | 1737 | WP_228962907.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ACDH70_RS18195 (ACDH70_18195) | pilB | 4271854..4271973 (+) | 120 | WP_029220459.1 | hypothetical protein | Machinery gene |
| ACDH70_RS18200 (ACDH70_18200) | pilB | 4272039..4272158 (+) | 120 | WP_029220459.1 | hypothetical protein | Machinery gene |
| ACDH70_RS18205 (ACDH70_18205) | pilR | 4272797..4274191 (-) | 1395 | WP_228962908.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ACDH70_RS18210 (ACDH70_18210) | - | 4274516..4276129 (-) | 1614 | WP_372360354.1 | PAS domain-containing sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4235.93 Da Isoelectric Point: 10.4810
>NTDB_id=1040009 ACDH70_RS18195 WP_029220459.1 4271854..4271973(+) (pilB) [Xanthomonas axonopodis pv. poinsettiicola strain NCPPB:1939]
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1040009 ACDH70_RS18195 WP_029220459.1 4271854..4271973(+) (pilB) [Xanthomonas axonopodis pv. poinsettiicola strain NCPPB:1939]
ATGCAGATCGCCGAGGCAGCGCAGAAGATTGGCATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGTCTGGCCGAGATCAATCGGGTGACCAAAGACTAG
ATGCAGATCGCCGAGGCAGCGCAGAAGATTGGCATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGTCTGGCCGAGATCAATCGGGTGACCAAAGACTAG
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baumannii D1279779 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilF | Neisseria gonorrhoeae MS11 |
40.541 |
94.872 |
0.385 |
| pilB | Vibrio cholerae strain A1552 |
42.857 |
89.744 |
0.385 |