Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ACCP93_RS14585 | Genome accession | NZ_CP167216 |
| Coordinates | 3378887..3379006 (-) | Length | 39 a.a. |
| NCBI ID | WP_136732873.1 | Uniprot ID | - |
| Organism | Xanthomonas campestris pv. fici strain NCPPB 2372 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 3373887..3384006
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ACCP93_RS14570 (ACCP93_14570) | sucC | 3373936..3375105 (-) | 1170 | WP_007965356.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| ACCP93_RS14575 (ACCP93_14575) | - | 3375337..3376950 (+) | 1614 | WP_218558976.1 | PAS domain-containing sensor histidine kinase | - |
| ACCP93_RS14580 (ACCP93_14580) | pilR | 3377219..3378673 (+) | 1455 | WP_218558977.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ACCP93_RS14585 (ACCP93_14585) | pilB | 3378887..3379006 (-) | 120 | WP_136732873.1 | pilus assembly protein | Machinery gene |
| ACCP93_RS14590 (ACCP93_14590) | pilB | 3379284..3381020 (-) | 1737 | WP_218558981.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ACCP93_RS14595 (ACCP93_14595) | pilA2 | 3381062..3381475 (-) | 414 | WP_005921365.1 | pilin | Machinery gene |
| ACCP93_RS14600 (ACCP93_14600) | comP | 3381572..3382000 (-) | 429 | WP_005921364.1 | pilin | Machinery gene |
| ACCP93_RS14605 (ACCP93_14605) | pilC | 3382345..3383604 (+) | 1260 | WP_033836749.1 | type II secretion system F family protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4166.87 Da Isoelectric Point: 11.0375
>NTDB_id=1038910 ACCP93_RS14585 WP_136732873.1 3378887..3379006(-) (pilB) [Xanthomonas campestris pv. fici strain NCPPB 2372]
MKIASATQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MKIASATQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1038910 ACCP93_RS14585 WP_136732873.1 3378887..3379006(-) (pilB) [Xanthomonas campestris pv. fici strain NCPPB 2372]
ATGAAGATCGCCAGCGCCACGCAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCCTTGATGAAGGCTGCCCACGGGGT
GACCAGCCTGGCCGAGATCAATCGGGTGACCAAGGACTAA
ATGAAGATCGCCAGCGCCACGCAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCCTTGATGAAGGCTGCCCACGGGGT
GACCAGCCTGGCCGAGATCAATCGGGTGACCAAGGACTAA
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Acinetobacter baylyi ADP1 |
48.718 |
100 |
0.487 |