Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ACCP88_RS05640 | Genome accession | NZ_CP167212 |
| Coordinates | 1237774..1237893 (+) | Length | 39 a.a. |
| NCBI ID | WP_029220459.1 | Uniprot ID | A0A7Z2ZHL3 |
| Organism | Xanthomonas axonopodis pv. cyamopsidis strain NCPPB 3758 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1232774..1242893
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ACCP88_RS05615 (ACCP88_05635) | - | 1232978..1233328 (+) | 351 | WP_372162904.1 | SMR family transporter | - |
| ACCP88_RS05620 (ACCP88_05640) | - | 1233333..1234127 (+) | 795 | WP_277573650.1 | glycosyltransferase | - |
| ACCP88_RS05625 (ACCP88_05645) | - | 1234142..1235170 (+) | 1029 | WP_372162906.1 | glycosyltransferase | - |
| ACCP88_RS05630 (ACCP88_05650) | - | 1235163..1235810 (+) | 648 | WP_277573648.1 | methionine biosynthesis protein MetW | - |
| ACCP88_RS05635 (ACCP88_05655) | pilB | 1235907..1237643 (+) | 1737 | WP_372163326.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ACCP88_RS05640 (ACCP88_05660) | pilB | 1237774..1237893 (+) | 120 | WP_029220459.1 | hypothetical protein | Machinery gene |
| ACCP88_RS05645 (ACCP88_05665) | pilR | 1238074..1239528 (-) | 1455 | WP_206212849.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ACCP88_RS05650 (ACCP88_05670) | - | 1239795..1241408 (-) | 1614 | WP_372162909.1 | ATP-binding protein | - |
| ACCP88_RS05655 (ACCP88_05675) | sucC | 1241640..1242809 (+) | 1170 | WP_007965356.1 | ADP-forming succinate--CoA ligase subunit beta | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4235.93 Da Isoelectric Point: 10.4810
>NTDB_id=1038885 ACCP88_RS05640 WP_029220459.1 1237774..1237893(+) (pilB) [Xanthomonas axonopodis pv. cyamopsidis strain NCPPB 3758]
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1038885 ACCP88_RS05640 WP_029220459.1 1237774..1237893(+) (pilB) [Xanthomonas axonopodis pv. cyamopsidis strain NCPPB 3758]
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGCGGAAATCAATCGGGTGACGAAGGACTGA
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGTATTCGCGATTTGCGCCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGCGGAAATCAATCGGGTGACGAAGGACTGA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baumannii D1279779 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilF | Neisseria gonorrhoeae MS11 |
40.541 |
94.872 |
0.385 |
| pilB | Vibrio cholerae strain A1552 |
42.857 |
89.744 |
0.385 |