Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   OMK57_RS12650 Genome accession   NZ_CP110264
Coordinates   2547661..2547834 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain HMB20199     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2542661..2552834
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  OMK57_RS12635 (OMK57_12635) gcvT 2543458..2544546 (-) 1089 WP_069487188.1 glycine cleavage system aminomethyltransferase GcvT -
  OMK57_RS12640 (OMK57_12640) - 2544990..2546663 (+) 1674 WP_059293610.1 DEAD/DEAH box helicase -
  OMK57_RS12645 (OMK57_12645) - 2546683..2547477 (+) 795 WP_044154602.1 YqhG family protein -
  OMK57_RS12650 (OMK57_12650) sinI 2547661..2547834 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  OMK57_RS12655 (OMK57_12655) sinR 2547868..2548203 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  OMK57_RS12660 (OMK57_12660) tasA 2548289..2549074 (-) 786 WP_059293609.1 biofilm matrix protein TasA -
  OMK57_RS12665 (OMK57_12665) sipW 2549139..2549723 (-) 585 WP_059293608.1 signal peptidase I SipW -
  OMK57_RS12670 (OMK57_12670) tapA 2549695..2550456 (-) 762 WP_069487187.1 amyloid fiber anchoring/assembly protein TapA -
  OMK57_RS12675 (OMK57_12675) - 2550733..2551056 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  OMK57_RS12680 (OMK57_12680) - 2551099..2551278 (-) 180 WP_003236949.1 YqzE family protein -
  OMK57_RS12685 (OMK57_12685) comGG 2551350..2551724 (-) 375 WP_059335411.1 competence type IV pilus minor pilin ComGG Machinery gene
  OMK57_RS12690 (OMK57_12690) comGF 2551725..2552108 (-) 384 WP_175422400.1 competence type IV pilus minor pilin ComGF Machinery gene
  OMK57_RS12695 (OMK57_12695) comGE 2552134..2552481 (-) 348 WP_069487185.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=753566 OMK57_RS12650 WP_024122036.1 2547661..2547834(+) (sinI) [Bacillus halotolerans strain HMB20199]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=753566 OMK57_RS12650 WP_024122036.1 2547661..2547834(+) (sinI) [Bacillus halotolerans strain HMB20199]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947