Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   NPA28_RS12685 Genome accession   NZ_CP101718
Coordinates   2518081..2518254 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain S-5     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2513081..2523254
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NPA28_RS12670 (NPA28_12670) gcvT 2513878..2514966 (-) 1089 WP_217827775.1 glycine cleavage system aminomethyltransferase GcvT -
  NPA28_RS12675 (NPA28_12675) - 2515410..2517083 (+) 1674 WP_059293610.1 DEAD/DEAH box helicase -
  NPA28_RS12680 (NPA28_12680) - 2517103..2517897 (+) 795 WP_256766236.1 YqhG family protein -
  NPA28_RS12685 (NPA28_12685) sinI 2518081..2518254 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  NPA28_RS12690 (NPA28_12690) sinR 2518288..2518623 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  NPA28_RS12695 (NPA28_12695) tasA 2518709..2519494 (-) 786 WP_059293609.1 biofilm matrix protein TasA -
  NPA28_RS12700 (NPA28_12700) sipW 2519559..2520143 (-) 585 WP_059293608.1 signal peptidase I SipW -
  NPA28_RS12705 (NPA28_12705) tapA 2520115..2520876 (-) 762 WP_217827776.1 amyloid fiber anchoring/assembly protein TapA -
  NPA28_RS12710 (NPA28_12710) - 2521153..2521476 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  NPA28_RS12715 (NPA28_12715) - 2521519..2521698 (-) 180 WP_003236949.1 YqzE family protein -
  NPA28_RS12720 (NPA28_12720) comGG 2521770..2522144 (-) 375 WP_217827777.1 competence type IV pilus minor pilin ComGG Machinery gene
  NPA28_RS12725 (NPA28_12725) comGF 2522145..2522528 (-) 384 WP_217827778.1 competence type IV pilus minor pilin ComGF Machinery gene
  NPA28_RS12730 (NPA28_12730) comGE 2522554..2522901 (-) 348 WP_217827779.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=711760 NPA28_RS12685 WP_024122036.1 2518081..2518254(+) (sinI) [Bacillus halotolerans strain S-5]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=711760 NPA28_RS12685 WP_024122036.1 2518081..2518254(+) (sinI) [Bacillus halotolerans strain S-5]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947