Detailed information
Overview
| Name | sinI | Type | Regulator |
| Locus tag | NPA28_RS12685 | Genome accession | NZ_CP101718 |
| Coordinates | 2518081..2518254 (+) | Length | 57 a.a. |
| NCBI ID | WP_024122036.1 | Uniprot ID | - |
| Organism | Bacillus halotolerans strain S-5 | ||
| Function | inhibit the expression of sinR (predicted from homology) Competence regulation |
||
Genomic Context
Location: 2513081..2523254
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NPA28_RS12670 (NPA28_12670) | gcvT | 2513878..2514966 (-) | 1089 | WP_217827775.1 | glycine cleavage system aminomethyltransferase GcvT | - |
| NPA28_RS12675 (NPA28_12675) | - | 2515410..2517083 (+) | 1674 | WP_059293610.1 | DEAD/DEAH box helicase | - |
| NPA28_RS12680 (NPA28_12680) | - | 2517103..2517897 (+) | 795 | WP_256766236.1 | YqhG family protein | - |
| NPA28_RS12685 (NPA28_12685) | sinI | 2518081..2518254 (+) | 174 | WP_024122036.1 | anti-repressor SinI | Regulator |
| NPA28_RS12690 (NPA28_12690) | sinR | 2518288..2518623 (+) | 336 | WP_003226345.1 | transcriptional regulator SinR | Regulator |
| NPA28_RS12695 (NPA28_12695) | tasA | 2518709..2519494 (-) | 786 | WP_059293609.1 | biofilm matrix protein TasA | - |
| NPA28_RS12700 (NPA28_12700) | sipW | 2519559..2520143 (-) | 585 | WP_059293608.1 | signal peptidase I SipW | - |
| NPA28_RS12705 (NPA28_12705) | tapA | 2520115..2520876 (-) | 762 | WP_217827776.1 | amyloid fiber anchoring/assembly protein TapA | - |
| NPA28_RS12710 (NPA28_12710) | - | 2521153..2521476 (+) | 324 | WP_024122040.1 | YqzG/YhdC family protein | - |
| NPA28_RS12715 (NPA28_12715) | - | 2521519..2521698 (-) | 180 | WP_003236949.1 | YqzE family protein | - |
| NPA28_RS12720 (NPA28_12720) | comGG | 2521770..2522144 (-) | 375 | WP_217827777.1 | competence type IV pilus minor pilin ComGG | Machinery gene |
| NPA28_RS12725 (NPA28_12725) | comGF | 2522145..2522528 (-) | 384 | WP_217827778.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| NPA28_RS12730 (NPA28_12730) | comGE | 2522554..2522901 (-) | 348 | WP_217827779.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
Sequence
Protein
Download Length: 57 a.a. Molecular weight: 6675.62 Da Isoelectric Point: 6.7231
>NTDB_id=711760 NPA28_RS12685 WP_024122036.1 2518081..2518254(+) (sinI) [Bacillus halotolerans strain S-5]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF
Nucleotide
Download Length: 174 bp
>NTDB_id=711760 NPA28_RS12685 WP_024122036.1 2518081..2518254(+) (sinI) [Bacillus halotolerans strain S-5]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| sinI | Bacillus subtilis subsp. subtilis str. 168 |
94.737 |
100 |
0.947 |