NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	L3474_RS09525	Genome accession	NZ_CP091450
Coordinates	1861414..1861716 (-)	Length	100 a.a.
NCBI ID	WP_000413380.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain 3641/15
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1856414..1866716

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
L3474_RS09490 (L3474_09425)	rnpA	1857100..1857471 (-)	372	WP_000739246.1	ribonuclease P protein component	-
L3474_RS09495	-	1857488..1857619 (-)	132	WP_000768904.1	hypothetical protein	-
L3474_RS09500 (L3474_09430)	-	1857620..1858810 (-)	1191	WP_000167766.1	acetate kinase	-
L3474_RS09505 (L3474_09435)	comYH	1858861..1859814 (-)	954	WP_000345119.1	class I SAM-dependent methyltransferase	Machinery gene
L3474_RS09510 (L3474_09440)	-	1859875..1860462 (-)	588	WP_000679774.1	class I SAM-dependent methyltransferase	-
L3474_RS09515 (L3474_09445)	comGG/cglG	1860599..1861012 (-)	414	WP_000265630.1	competence type IV pilus minor pilin ComGG	Machinery gene
L3474_RS09520 (L3474_09450)	comGF/cglF	1860990..1861451 (-)	462	WP_000250545.1	competence type IV pilus minor pilin ComGF	Machinery gene
L3474_RS09525 (L3474_09455)	comGE/cglE	1861414..1861716 (-)	303	WP_000413380.1	competence type IV pilus minor pilin ComGE	Machinery gene
L3474_RS09530 (L3474_09460)	comGD/cglD	1861679..1862083 (-)	405	WP_000588005.1	competence type IV pilus minor pilin ComGD	Machinery gene
L3474_RS09535 (L3474_09465)	comGC/cglC	1862076..1862402 (-)	327	WP_000738650.1	comG operon protein ComGC	Machinery gene
L3474_RS09540 (L3474_09470)	comGB/cglB	1862404..1863420 (-)	1017	WP_013193332.1	competence type IV pilus assembly protein ComGB	Machinery gene
L3474_RS09545 (L3474_09475)	comGA/cglA/cilD	1863368..1864309 (-)	942	WP_000249567.1	competence type IV pilus ATPase ComGA	Machinery gene
L3474_RS09550 (L3474_09480)	-	1864385..1864750 (-)	366	WP_000286415.1	DUF1033 family protein	-
L3474_RS09555 (L3474_09485)	-	1864901..1865959 (-)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11135.11 Da Isoelectric Point: 9.7273

                                >NTDB_id=651282 L3474_RS09525 WP_000413380.1 1861414..1861716(-) (comGE/cglE) [Streptococcus pneumoniae strain 3641/15]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVNINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=651282 L3474_RS09525 WP_000413380.1 1861414..1861716(-) (comGE/cglE) [Streptococcus pneumoniae strain 3641/15]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCTTGCAGACAGGTCAAAATCAGGTAAACATAAACGGAGTTGAGATTCAGGTGTTTTCT

AGCGAAAAGGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus mitis NCTC 12261	99	100	0.99
comGE/cglE	Streptococcus pneumoniae Rx1	99	100	0.99
comGE/cglE	Streptococcus pneumoniae D39	99	100	0.99
comGE/cglE	Streptococcus pneumoniae R6	99	100	0.99
comGE/cglE	Streptococcus pneumoniae TIGR4	99	100	0.99
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	43.333	90	0.39
comYE	Streptococcus mutans UA159	43.333	90	0.39

Detailed information NTG0651282