Detailed information    

experimental Experimentally validated

Overview

Name   comS   Type   Regulator
Locus tag   - Genome accession   NZ_CP029560
Coordinates   39857..39922 (+) Length   22 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus sobrinus strain NIDR 6715-7     
Function   activate transcription of comX; activate transcription of comS   
Competence regulation

Function

XIP increases the expression of the comX, ssbB, and cglA genes in strain NIDR 6715-7.


Genomic Context

Location: 34857..44922
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  DLJ51_RS00245 (DLJ51_00245) - 35402..36121 (+) 720 WP_109833385.1 hypothetical protein -
  DLJ51_RS10715 - 36363..36491 (+) 129 WP_019768926.1 hypothetical protein -
  DLJ51_RS00250 (DLJ51_00250) - 36622..36852 (+) 231 WP_002959611.1 hypothetical protein -
  DLJ51_RS00255 (DLJ51_00255) - 37116..38453 (+) 1338 WP_019768925.1 hypothetical protein -
  DLJ51_RS00260 (DLJ51_00260) - 38479..38637 (+) 159 WP_019768924.1 bacteriocin -
  DLJ51_RS00265 (DLJ51_00265) comR/comR1 38804..39709 (+) 906 WP_109982338.1 XRE family transcriptional regulator Regulator
  - comS 39857..39922 (+) 66 - - Regulator
  DLJ51_RS00270 (DLJ51_00270) comA 39969..42086 (+) 2118 WP_019772678.1 peptide cleavage/export ABC transporter Regulator
  DLJ51_RS00275 (DLJ51_00275) comR/comR2 42279..43181 (+) 903 WP_109982339.1 XRE family transcriptional regulator Regulator
  DLJ51_RS00280 (DLJ51_00280) - 43311..44183 (-) 873 WP_109982340.1 helix-turn-helix domain-containing protein -

Regulatory network

Positive effect      
Negative effect
Regulator Target Regulation
  comS comX positive effect
  comS comGA/cglA positive effect
  comS ssbB positive effect

Sequence

Protein


Download         Length: 22 a.a.        Molecular weight: 2459.15 Da        Isoelectric Point: 9.5102

>NTDB_id=581 39857..39922(+) (comS) [Streptococcus sobrinus strain NIDR 6715-7]
MNLKKIIELAITLVALMCTIAR

Nucleotide


Download         Length: 66 bp        

>NTDB_id=581 39857..39922(+) (comS) [Streptococcus sobrinus strain NIDR 6715-7]
ATGAACTTGAAAAAGATTATTGAATTAGCAATCACGCTTGTAGCTTTAATGTGTACAATTGCACGT

XIP

This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

LMCTIAR


Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value

References

[1] J W Li et al. (2021) A Novel Competence Pathway in the Oral Pathogen Streptococcus sobrinus. Journal of Dental Research 100(5):542-548. [PMID: 33876976]