Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   JWY36_RS02095 Genome accession   NZ_CP071276
Coordinates   415973..416095 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain JNFE0126     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 410973..421095
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  JWY36_RS02080 (JWY36_02060) yclJ 412587..413270 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  JWY36_RS02085 (JWY36_02065) yclK 413257..414678 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  JWY36_RS02090 (JWY36_02070) rapC 414841..415989 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  JWY36_RS02095 (JWY36_02075) phrC 415973..416095 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  JWY36_RS02100 (JWY36_02080) yczM 416194..416283 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  JWY36_RS02105 (JWY36_02085) yczN 416365..416478 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  JWY36_RS02110 (JWY36_02090) thrD 416631..417995 (-) 1365 WP_014478832.1 aspartate kinase -
  JWY36_RS02115 (JWY36_02095) ceuB 418386..419336 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  JWY36_RS02120 (JWY36_02100) yclO 419329..420276 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  JWY36_RS02125 (JWY36_02105) yclP 420270..421028 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=544468 JWY36_RS02095 WP_003224994.1 415973..416095(+) (phrC) [Bacillus subtilis strain JNFE0126]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=544468 JWY36_RS02095 WP_003224994.1 415973..416095(+) (phrC) [Bacillus subtilis strain JNFE0126]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1