Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   HC658_RS02170 Genome accession   NZ_CP051466
Coordinates   429642..429764 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain UCMB5021     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424642..434764
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HC658_RS02155 (HC658_04240) yclJ 426256..426939 (+) 684 WP_032722955.1 two-component system response regulator YclJ -
  HC658_RS02160 (HC658_04250) yclK 426926..428347 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  HC658_RS02165 (HC658_04260) rapC 428510..429658 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  HC658_RS02170 (HC658_04270) phrC 429642..429764 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  HC658_RS02175 yczM 429864..429953 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  HC658_RS02180 yczN 430035..430148 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  HC658_RS02185 (HC658_04280) thrD 430301..431665 (-) 1365 WP_015715246.1 aspartate kinase -
  HC658_RS02190 (HC658_04290) ceuB 432050..433000 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  HC658_RS02195 (HC658_04300) yclO 432993..433940 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  HC658_RS02200 (HC658_04310) yclP 433934..434692 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=438618 HC658_RS02170 WP_003224994.1 429642..429764(+) (phrC) [Bacillus subtilis subsp. subtilis strain UCMB5021]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=438618 HC658_RS02170 WP_003224994.1 429642..429764(+) (phrC) [Bacillus subtilis subsp. subtilis strain UCMB5021]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1