Detailed information
Overview
| Name | comC/blpC | Type | Regulator |
| Locus tag | IBL27_RS01305 | Genome accession | NZ_CP061071 |
| Coordinates | 263978..264109 (-) | Length | 43 a.a. |
| NCBI ID | WP_002268639.1 | Uniprot ID | Q9APK6 |
| Organism | Streptococcus mutans B04Sm5 | ||
| Function | binding to ComD; induce autophosphorylation of ComD; regulation of comX expression (predicted from homology) Competence regulation |
||
Genomic Context
Location: 258978..269109
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| IBL27_RS01285 (IBL27_01285) | - | 259952..260578 (+) | 627 | WP_002278266.1 | hypothetical protein | - |
| IBL27_RS01290 (IBL27_01290) | - | 260626..261264 (+) | 639 | WP_002265117.1 | VTT domain-containing protein | - |
| IBL27_RS01295 (IBL27_01295) | comE/blpR | 261735..262487 (+) | 753 | WP_002270252.1 | response regulator transcription factor | Regulator |
| IBL27_RS01300 (IBL27_01300) | comD/blpH | 262484..263809 (+) | 1326 | WP_002308983.1 | sensor histidine kinase | Regulator |
| IBL27_RS01305 (IBL27_01305) | comC/blpC | 263978..264109 (-) | 132 | WP_002268639.1 | ComC/BlpC family leader-containing pheromone/bacteriocin | Regulator |
| IBL27_RS01310 (IBL27_01310) | cipB | 264376..264606 (+) | 231 | WP_002309764.1 | Blp family class II bacteriocin | Regulator |
| IBL27_RS01315 (IBL27_01315) | - | 264737..265138 (+) | 402 | WP_002310604.1 | hypothetical protein | - |
| IBL27_RS01320 (IBL27_01320) | - | 266518..266937 (+) | 420 | WP_002263913.1 | hypothetical protein | - |
| IBL27_RS01325 (IBL27_01325) | - | 267084..267488 (+) | 405 | WP_002263912.1 | hypothetical protein | - |
| IBL27_RS09845 | - | 267611..267823 (-) | 213 | Protein_238 | IS3 family transposase | - |
| IBL27_RS01330 (IBL27_01330) | - | 268263..268427 (+) | 165 | WP_002265308.1 | hypothetical protein | - |
| IBL27_RS01335 (IBL27_01335) | - | 268832..269044 (+) | 213 | WP_002309424.1 | Blp family class II bacteriocin | - |
Sequence
Protein
Download Length: 43 a.a. Molecular weight: 4926.71 Da Isoelectric Point: 10.1937
>NTDB_id=419757 IBL27_RS01305 WP_002268639.1 263978..264109(-) (comC/blpC) [Streptococcus mutans B04Sm5]
MKKTLSLKNDFKEIKTDELEIIIGGSGTLSTFFRLFNRSFTQA
MKKTLSLKNDFKEIKTDELEIIIGGSGTLSTFFRLFNRSFTQA
Nucleotide
Download Length: 132 bp
>NTDB_id=419757 IBL27_RS01305 WP_002268639.1 263978..264109(-) (comC/blpC) [Streptococcus mutans B04Sm5]
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAAACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AACCCTGTCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTAG
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAAACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AACCCTGTCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTAG
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comC/blpC | Streptococcus mutans UA159 |
97.674 |
100 |
0.977 |
| comC/comC1 | Streptococcus pneumoniae R6 |
44.444 |
83.721 |
0.372 |
| comC/comC1 | Streptococcus pneumoniae G54 |
44.444 |
83.721 |
0.372 |
| comC/comC1 | Streptococcus pneumoniae D39 |
44.444 |
83.721 |
0.372 |
| comC/comC1 | Streptococcus pneumoniae Rx1 |
44.444 |
83.721 |
0.372 |